;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/alleles/allele_genetic_interactions_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/alleles/allele_genetic_interactions_fb_2023_04.tsv
!(file-name allele_genetic_interactions  data/ftp.flybase.net/releases/current/precomputed_files/alleles/allele_genetic_interactions_fb_2023_04.tsv)
(num-columns allele_genetic_interactions 4)
(duplicated-rows allele_genetic_interactions 21)
(total-rows allele_genetic_interactions 363452)
(unique-values allele_genetic_interactions 1 28688 object)
(unique-values allele_genetic_interactions 2 28685 object)
(unique-values allele_genetic_interactions 3 227000 object)
(unique-values allele_genetic_interactions 4 8034 object)
(missing-values allele_genetic_interactions 1 0 () ())
(null-value-count allele_genetic_interactions 2 "" 19)
(missing-values allele_genetic_interactions 2 19 (# "") (# 19))
(null-value-count allele_genetic_interactions 3 "" 19)
(missing-values allele_genetic_interactions 3 19 (# "") (# 19))
(null-value-count allele_genetic_interactions 4 "" 38)
(missing-values allele_genetic_interactions 4 38 (# "") (# 38))
(most-frequent allele_genetic_interactions 1 (# (# "Scer\\GAL4[hs.2sev]" 1793) (# "Scer\\GAL4[elav.PU]" 1893) (# "Scer\\GAL4[Bx-MS1096]" 1990) (# "Scer\\GAL4[ey.PH]" 2227) (# "Scer\\GAL4[elav-C155]" 2526) (# "Scer\\GAL4[GMR.PU]" 9205) (# "Scer\\GAL4[GMR.PF]" 14267)))
(less-frequent allele_genetic_interactions 1 (# (# "Su(mg)2-1[2-1]" 1) (# "dnt[ap.ME4]" 1) (# "Fas2[unspecified]" 1) (# "dock[R336Q.UAS]" 1) (# "dock[W151K.UAS]" 1) (# "dock[W225K.UAS]" 1) (# "dock[W48K.UAS]" 1)))
(most-frequent allele_genetic_interactions 2 (# (# FBal0042580 1793) (# FBal0241645 1893) (# FBal0040476 1990) (# FBal0093300 2227) (# FBal0047071 2526) (# FBal0240667 9205) (# FBal0244011 14267)))
(less-frequent allele_genetic_interactions 2 (# (# FBal0083171 1) (# FBal0094549 1) (# FBal0104139 1) (# FBal0089352 1) (# FBal0089350 1) (# FBal0089348 1) (# FBal0089346 1)))
(most-frequent allele_genetic_interactions 3 (# (# "Scer\\GAL4[Bx-MS1096], mir-286[UAS.cluster.cLc], mir-309[UAS.cluster.cLc], mir-3[UAS.cluster.cLc], mir-4[UAS.cluster.cLc], mir-5[UAS.cluster.cLc], mir-6-1[UAS.cluster.cLc], mir-6-2[UAS.cluster.cLc], mir-6-3[UAS.cluster.cLc] has wing phenotype" 8) (# "Scer\\GAL4[Bx-MS1096], mir-286[UAS.cluster.cLc], mir-309[UAS.cluster.cLc], mir-3[UAS.cluster.cLc], mir-4[UAS.cluster.cLc], mir-5[UAS.cluster.cLc], mir-6-1[UAS.cluster.cLc], mir-6-2[UAS.cluster.cLc], mir-6-3[UAS.cluster.cLc] has lethal phenotype" 8) (# "Delta[UAS.cDa], Scer\\GAL4[ey.PH], lola[GS88A8], psq[GS88A8] has neoplasia phenotype" 9) (# "rho[ve-1], vn[1] has wing vein phenotype" 10) (# "Dp[GMR.PD], E2f1[GMR.PD] has eye phenotype" 10) (# "Delta[UAS.cDa], Scer\\GAL4[ey.PH], lola[GS88A8], psq[GS88A8] has eye phenotype" 18)))
(less-frequent allele_genetic_interactions 3 (# (# "1038[1038] is an enhancer of visible phenotype of vg[83b27]/vg[1]" 1) (# "bas[1] is an enhancer of paralytic phenotype of para[bss1]" 1) (# "baz[4] has abnormal cell polarity phenotype, enhanceable by Dhc64C[6-6]/Dhc64C[6-8]" 1) (# "baz[4] has abnormal neuroanatomy phenotype, non-enhanceable by aPKC[Exc55]" 1) (# "baz[4] has abnormal neuroanatomy phenotype, non-suppressible by aPKC[Exc55]" 1) (# "baz[4] has bouton phenotype, non-enhanceable by aPKC[Exc55]" 1) (# "baz[4] has bouton phenotype, non-suppressible by aPKC[Exc55]" 1)))
(most-frequent allele_genetic_interactions 4 (# (# FBrf0179402 1369) (# FBrf0237532 1506) (# FBrf0147055 1723) (# FBrf0246190 1852) (# FBrf0190765 1868) (# FBrf0199094 1940) (# FBrf0187664 2514)))
(less-frequent allele_genetic_interactions 4 (# (# FBrf0158937 1) (# FBrf0159209 1) (# FBrf0192307 1) (# FBrf0226217 1) (# FBrf0160985 1) (# FBrf0134563 1) (# FBrf0235180 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/alleles/fbal_to_fbgn_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/alleles/fbal_to_fbgn_fb_2023_04.tsv
!(file-name fbal_to_fbgn  data/ftp.flybase.net/releases/current/precomputed_files/alleles/fbal_to_fbgn_fb_2023_04.tsv)
(num-columns fbal_to_fbgn 4)
(duplicated-rows fbal_to_fbgn 0)
(total-rows fbal_to_fbgn 288468)
(unique-values fbal_to_fbgn 1 288468 object)
(unique-values fbal_to_fbgn 2 288454 object)
(unique-values fbal_to_fbgn 3 33136 object)
(unique-values fbal_to_fbgn 4 33136 object)
(missing-values fbal_to_fbgn 1 0 () ())
(missing-values fbal_to_fbgn 2 0 () ())
(null-value-count fbal_to_fbgn 3 "" 58)
(missing-values fbal_to_fbgn 3 58 (# "") (# 58))
(null-value-count fbal_to_fbgn 4 "" 58)
(missing-values fbal_to_fbgn 4 58 (# "") (# 58))
(most-frequent fbal_to_fbgn 2 (# (# "abd-A[HCJ32" 2) (# "Ecol\\lacZ[HCJ32" 2) (# "Ecol\\lacZ[Dora-PL29" 2) (# "abd-A[HC184B-HCJ32" 2) (# "Mhc[" 2) (# "y[2" 3) (# "y[1" 5)))
(less-frequent fbal_to_fbgn 2 (# (# "Xrp1[142]" 1) (# "Apc2[45]" 1) (# "Apc2[5-3]" 1) (# "Apc2[Delta20rep.Tag:HA]" 1) (# "TBC1d7[Apc2-79]" 1) (# "mRpS24[Apc2-79]" 1) (# "mRpS24[+t3.78]" 1)))
(most-frequent fbal_to_fbgn 3 (# (# FBgn0004034 989) (# FBgn0003996 1474) (# FBgn0015250 2466) (# FBgn0262639 3340) (# FBgn0014446 4731) (# FBgn0014447 12710) (# FBgn0014445 30381)))
(less-frequent fbal_to_fbgn 3 (# (# FBgn0267024 1) (# FBgn0044109 1) (# FBgn0018700 1) (# FBgn0014164 1) (# FBgn0003537 1) (# FBgn0002275 1) (# FBgn0001163 1)))
(most-frequent fbal_to_fbgn 4 (# (# y 989) (# w 1474) (# "Ecol\\lexA" 2466) (# "Hsap\\RELA" 3340) (# "Avic\\GFP" 4731) (# "Ecol\\lacZ" 12710) (# "Scer\\GAL4" 30381)))
(less-frequent fbal_to_fbgn 4 (# (# "asRNA:CR45468" 1) (# "E(rst)C383" 1) (# "Dpau\\v" 1) (# fez 1) (# "Stp-1" 1) (# "l(3)70Ac" 1) (# GustR 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/alleles/genotype_phenotype_data_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/alleles/genotype_phenotype_data_fb_2023_04.tsv
!(file-name genotype_phenotype_data  data/ftp.flybase.net/releases/current/precomputed_files/alleles/genotype_phenotype_data_fb_2023_04.tsv)
(num-columns genotype_phenotype_data 7)
(duplicated-rows genotype_phenotype_data 1032)
(total-rows genotype_phenotype_data 384206)
(unique-values genotype_phenotype_data 1 155953 object)
(unique-values genotype_phenotype_data 2 155919 object)
(unique-values genotype_phenotype_data 3 3603 object)
(unique-values genotype_phenotype_data 4 3608 object)
(unique-values genotype_phenotype_data 5 1340 object)
(unique-values genotype_phenotype_data 6 1348 object)
(unique-values genotype_phenotype_data 7 19007 object)
(missing-values genotype_phenotype_data 1 0 () ())
(null-value-count genotype_phenotype_data 2 "" 321)
(missing-values genotype_phenotype_data 2 321 (# "") (# 321))
(null-value-count genotype_phenotype_data 3 "" 321)
(missing-values genotype_phenotype_data 3 321 (# "") (# 321))
(null-value-count genotype_phenotype_data 4 "" 321)
(missing-values genotype_phenotype_data 4 321 (# "") (# 321))
(null-value-count genotype_phenotype_data 5 "" 242201)
(missing-values genotype_phenotype_data 5 242201 (# "") (# 242201))
(null-value-count genotype_phenotype_data 6 "" 242201)
(missing-values genotype_phenotype_data 6 242201 (# "") (# 242201))
(null-value-count genotype_phenotype_data 7 "" 321)
(missing-values genotype_phenotype_data 7 321 (# "") (# 321))
(most-frequent genotype_phenotype_data 1 (# (# "hid[GMR.PG]" 177) (# "numb[1]" 190) (# "wg[l-17]" 198) (# "N[l1N-ts1]" 238) (# "y[1" 242) (# "N[55e11]" 261) (# "Pink1[B9]" 316)))
(less-frequent genotype_phenotype_data 1 (# (# "Scer\\GAL4[elav.PLu] y[GD1564] Dcr-2[UAS.cDa]" 1) (# "Scer\\GAL4[nub-AC-62] Slu7[HMC04054]" 1) (# "Scer\\GAL4[nub-AC-62] Sf3b6[HMS02566]" 1) (# "Scer\\GAL4[nub-AC-62] Sf3b5[HMS00097]" 1) (# "Scer\\GAL4[nub-AC-62] Sf3b1[HMS00055]" 1) (# "Scer\\GAL4[nub-AC-62] Sf3a2[HMC03799]" 1) (# "Scer\\GAL4[nub-AC-62] Sf3a1[HMS00157]" 1)))
(most-frequent genotype_phenotype_data 2 (# (# FBal0265023 177) (# FBal0013186 190) (# FBal0018509 198) (# FBal0012887 238) (# FBal0012701 261) (# FBal0193144 316)))
(less-frequent genotype_phenotype_data 2 (# (# FBal0244778 1) (# "FBal0058766 FBal0150204" 1) (# "FBal0058766 FBal0150205" 1) (# "FBal0147425 FBal0241645 FBal0299692" 1) (# "FBal0058766 FBal0215661" 1) (# "FBal0147425 FBal0241645 FBal0290792" 1) (# "FBal0058766 FBal0277700" 1)))
(most-frequent genotype_phenotype_data 3 (# (# "lethal - all die during embryonic stage" 5395) (# eye 8272) (# "abnormal neuroanatomy" 9153) (# wing 10701) (# visible 24435) (# lethal 35360) (# viable 47447)))
(less-frequent genotype_phenotype_data 3 (# (# "rough endoplasmic reticulum membrane" 1) (# "muscle cell of basalar muscle 49" 1) (# "gonadal sheath" 1) (# "visceral muscle cell" 1) (# "A1-7 ventral acute muscle cell" 1) (# "pupal s-LNv neuron" 1) (# "larval s-LNv neuron" 1)))
(most-frequent genotype_phenotype_data 4 (# (# FBcv0002033 5395) (# FBbt00004508 8272) (# FBcv0000435 9153) (# FBbt00004729 10701) (# FBcv0000354 24435) (# FBcv0000351 35360) (# FBcv0000349 47447)))
(less-frequent genotype_phenotype_data 4 (# (# FBbt00001314 1) (# FBbt00110023 1) (# FBbt00110022 1) (# FBbt00002511 1) (# FBbt00067044 1) (# FBbt00067062 1) (# FBbt00017021 1)))
(most-frequent genotype_phenotype_data 5 (# (# "embryonic stage" 4459) (# "somatic clone" 8931) (# "larval stage" 9821) (# "third instar larval stage" 9888) (# "adult stage" 16290) (# recessive 40476)))
(less-frequent genotype_phenotype_data 5 (# (# "germline clone|embryonic stage 13" 1) (# "somatic clone - tissue specific|decreased number" 1) (# "oogenesis|decreased number|germline clone" 1) (# "germline clone|decreased number" 1) (# "recessive|first instar larval stage|maternal effect" 1) (# "maternal effect|second instar larval stage|recessive" 1) (# "larval stage|somatic clone|cell autonomous|decreased number" 1)))
(most-frequent genotype_phenotype_data 6 (# (# FBdv00005289 4459) (# FBcv0000336 8931) (# FBdv00005336 9821) (# FBdv00005339 9888) (# FBdv00005369 16290) (# FBcv0000298 40476)))
(less-frequent genotype_phenotype_data 6 (# (# FBcv0000732 1) (# "FBcv0000333|FBdv00005369|FBcv0000793" 1) (# "FBcv0000153|FBcv0000068" 1) (# "FBcv0000058|FBcv0000061" 1) (# "FBcv0000336|FBdv00005339|FBcv0000061" 1) (# "FBcv0007050|FBdv00007001|FBcv0000068" 1) (# "FBcv0007048|FBdv00005338" 1)))
(most-frequent genotype_phenotype_data 7 (# (# FBrf0132177 2452) (# FBrf0179797 2682) (# FBrf0210524 7345) (# FBrf0212295 11407) (# FBrf0210226 11838) (# unattributed 15059) (# FBrf0214518 19955)))
(less-frequent genotype_phenotype_data 7 (# (# FBrf0189827 1) (# FBrf0179942 1) (# FBrf0206908 1) (# FBrf0183397 1) (# FBrf0023153 1) (# FBrf0221688 1) (# FBrf0237982 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/clones/cDNA_clone_data_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/clones/cDNA_clone_data_fb_2023_04.tsv
!(file-name cDNA_clone_data  data/ftp.flybase.net/releases/current/precomputed_files/clones/cDNA_clone_data_fb_2023_04.tsv)
(num-columns cDNA_clone_data 6)
(duplicated-rows cDNA_clone_data 0)
(total-rows cDNA_clone_data 722570)
(unique-values cDNA_clone_data 1 722570 object)
(unique-values cDNA_clone_data 2 4 object)
(unique-values cDNA_clone_data 3 722570 object)
(unique-values cDNA_clone_data 4 50 object)
(unique-values cDNA_clone_data 5 22711 object)
(unique-values cDNA_clone_data 6 696400 object)
(missing-values cDNA_clone_data 1 0 () ())
(missing-values cDNA_clone_data 2 0 () ())
(null-value-count cDNA_clone_data 3 "unknown" 1)
(missing-values cDNA_clone_data 3 1 (# unknown) (# 1))
(null-value-count cDNA_clone_data 4 "" 354)
(missing-values cDNA_clone_data 4 354 (# "") (# 354))
(null-value-count cDNA_clone_data 5 "" 696444)
(missing-values cDNA_clone_data 5 696444 (# "") (# 696444))
(null-value-count cDNA_clone_data 6 "" 26168)
(missing-values cDNA_clone_data 6 26168 (# "") (# 26168))
(most-frequent cDNA_clone_data 2 (# (# Dsim 239) (# Dyak 426) (# Dpse 13648) (# Dmel 708257)))
(less-frequent cDNA_clone_data 2 (# (# Dsim 239) (# Dyak 426) (# Dpse 13648) (# Dmel 708257)))
(most-frequent cDNA_clone_data 4 (# (# "SD_cDNA" 18885) (# "GH_cDNA" 20768) (# "AT_cDNA" 22564) (# "RH_cDNA" 52475) (# "RE_cDNA" 58036) (# "EK_EP_cDNA" 161904) (# "RP_cDNA" 220083)))
(less-frequent cDNA_clone_data 4 (# (# "TB_cDNA" 3) (# "TA_cDNA" 36) (# "DE-ORESTES_cDNA" 61) (# "CB_cDNA" 61) (# "AM_cDNA" 84) (# "ST_cDNA" 85) (# "RT_pCR8_cDNA" 156)))
(most-frequent cDNA_clone_data 5 (# (# AY069671 2) (# AY051957 2) (# AY061414 2) (# AY069707 2) (# AY051914 2) (# AY231748 3)))
(less-frequent cDNA_clone_data 5 (# (# BT150453 1) (# BT050556 1) (# BT010219 1) (# BT125004 1) (# BT006005 1) (# BT099857 1) (# BT100119 1)))
(most-frequent cDNA_clone_data 6 (# (# GH897620 1) (# GH934971 1) (# CA807794 1) (# AI256966 2) (# BI636404 2) (# BI633401 2)))
(less-frequent cDNA_clone_data 6 (# (# CA807794 1) (# GH872553 1) (# GH881842 1) (# GH911192 1) (# GH817175 1) (# GH899993 1) (# GH918491 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/clones/genomic_clone_data_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/clones/genomic_clone_data_fb_2023_04.tsv
!(file-name genomic_clone_data  data/ftp.flybase.net/releases/current/precomputed_files/clones/genomic_clone_data_fb_2023_04.tsv)
(num-columns genomic_clone_data 4)
(duplicated-rows genomic_clone_data 0)
(total-rows genomic_clone_data 50400)
(unique-values genomic_clone_data 1 50400 object)
(unique-values genomic_clone_data 2 1 object)
(unique-values genomic_clone_data 3 50400 object)
(unique-values genomic_clone_data 4 970 object)
(missing-values genomic_clone_data 1 0 () ())
(missing-values genomic_clone_data 2 0 () ())
(missing-values genomic_clone_data 3 0 () ())
(null-value-count genomic_clone_data 4 "" 49428)
(missing-values genomic_clone_data 4 49428 (# "") (# 49428))
(most-frequent genomic_clone_data 2 (# (# Dmel 50400)))
(less-frequent genomic_clone_data 2 (# (# Dmel 50400)))
(most-frequent genomic_clone_data 4 (# (# AC104703 1) (# AC010031 1) (# AC069405 1) (# AC011662 2) (# AC098575 2) (# AC009888 2)))
(less-frequent genomic_clone_data 4 (# (# AC105774 1) (# AC091226 1) (# AC069405 1) (# AC154046 1) (# AC010031 1) (# AC104703 1) (# AC010573 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/collaborators/fbgn_uniprot_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/collaborators/fbgn_uniprot_fb_2023_04.tsv
!(file-name fbgn_uniprot  data/ftp.flybase.net/releases/current/precomputed_files/collaborators/fbgn_uniprot_fb_2023_04.tsv)
(num-columns fbgn_uniprot 4)
(duplicated-rows fbgn_uniprot 0)
(total-rows fbgn_uniprot 32529)
(unique-values fbgn_uniprot 1 17130 object)
(unique-values fbgn_uniprot 2 17130 object)
(unique-values fbgn_uniprot 3 13964 object)
(unique-values fbgn_uniprot 4 32341 object)
(missing-values fbgn_uniprot 1 0 () ())
(missing-values fbgn_uniprot 2 0 () ())
(null-value-count fbgn_uniprot 3 "" 4918)
(missing-values fbgn_uniprot 3 4918 (# "") (# 4918))
(missing-values fbgn_uniprot 4 0 () ())
(most-frequent fbgn_uniprot 1 (# (# FBgn0265045 40) (# FBgn0013885 49) (# FBgn0002022 50) (# FBgn0285944 56) (# FBgn0033159 79) (# FBgn0082496 101) (# FBgn0003731 267)))
(less-frequent fbgn_uniprot 1 (# (# FBgn0000008 1) (# FBgn0040211 1) (# FBgn0040235 1) (# FBgn0040239 1) (# FBgn0040250 1) (# FBgn0040251 1) (# FBgn0040252 1)))
(most-frequent fbgn_uniprot 2 (# (# "Strn-Mlck" 40) (# "Dsub\\Acph-1" 49) (# Catsup 50) (# para 56) (# Dscam1 79) (# "Dpmo\\bi" 101) (# Egfr 267)))
(less-frequent fbgn_uniprot 2 (# (# a 1) (# hgo 1) (# "c12.1" 1) (# bc10 1) (# Ugt304A1 1) (# Ugt302K1 1) (# Ugt303A1 1)))
(most-frequent fbgn_uniprot 3 (# (# CG33950 32) (# CG44162 40) (# CG10449 50) (# CG9907 56) (# CG17800 79) (# CG10079 267)))
(less-frequent fbgn_uniprot 3 (# (# CG6741 1) (# CG9913 1) (# CG3172 1) (# CG14356 1) (# CG14355 1) (# CG9722 1) (# CG9649 1)))
(most-frequent fbgn_uniprot 4 (# (# Q7KV12 5) (# Q5F4J7 6) (# P02255 18) (# P84051 18) (# P02299 24) (# P02283 24) (# P84040 24)))
(less-frequent fbgn_uniprot 4 (# (# A0A0B4LG21 1) (# Q9GST6 1) (# Q9GST1 1) (# Q9GN59 1) (# Q9GNH0 1) (# Q9GPD9 1) (# Q9GNH4 1)))
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/collaborators/gp_information.fb
!(file-name gp_informatio  data/ftp.flybase.net/releases/current/precomputed_files/collaborators/gp_information.fb)
(num-columns gp_informatio 2)
(duplicated-rows gp_informatio 8413)
(total-rows gp_informatio 11695)
(unique-values gp_informatio 1 1885 object)
(unique-values gp_informatio 2 1851 object)
(missing-values gp_informatio 1 0 () ())
(missing-values gp_informatio 2 0 () ())
(most-frequent gp_informatio 1 (# (# at 24) (# kinase 35) (# factor 47) (# of 60) (# P450 82) (# receptor 203) (# protein 334)))
(less-frequent gp_informatio 1 (# (# "07/24/2023" 1) (# "receptor\tCG30106\tprotein\ttaxon:7227\t\tUniProtKB:A1ZAX0\t" 1) (# "1b\tCG6446\tprotein\ttaxon:7227\t\tUniProtKB:O44253|UniProtKB:Q7KK54\t" 1) (# "55B\tCG5765\tprotein\ttaxon:7227\t\tUniProtKB:Q8SXS5|UniProtKB:A1ZB24\t" 1) (# "K[+]" 1) (# shock 1) (# MCU 1)))
(most-frequent gp_informatio 2 (# (# "1\tCG17725\tprotein\ttaxon:7227\t\tUniProtKB:P20007\t" 1) (# "6\tCG15068\tprotein\ttaxon:7227\t\tUniProtKB:A1ZB64\t" 1) (# "2\tCG15067\tprotein\ttaxon:7227\t\tUniProtKB:Q8SYA7|UniProtKB:A1ZB61\t" 1) (# "1\tCG15066\tprotein\ttaxon:7227\t\tUniProtKB:Q9V8F5\t" 1) (# "regulator\tCG17680\tprotein\ttaxon:7227\t\tUniProtKB:Q7JX57\t" 1) (# "channel\tCG5076\tprotein\ttaxon:7227\t\tUniProtKB:Q23974|UniProtKB:A1ZB14|UniProtKB:A0A0B4LGW2\t" 1) (# "$" 1)))
(less-frequent gp_informatio 2 (# (# "$" 1) (# "1\tCG15066\tprotein\ttaxon:7227\t\tUniProtKB:Q9V8F5\t" 1) (# "2\tCG15067\tprotein\ttaxon:7227\t\tUniProtKB:Q8SYA7|UniProtKB:A1ZB61\t" 1) (# "6\tCG15068\tprotein\ttaxon:7227\t\tUniProtKB:A1ZB64\t" 1) (# "1\tCG17725\tprotein\ttaxon:7227\t\tUniProtKB:P20007\t" 1) (# "2\tCG10924\tprotein\ttaxon:7227\t\tUniProtKB:Q7JXB5|UniProtKB:A8DYI3\t" 1) (# "1\tCG5170\tprotein\ttaxon:7227\t\tUniProtKB:Q7KN84|UniProtKB:Q95T04|UniProtKB:Q9U982|UniProtKB:Q7KN75\t" 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/collaborators/pmid_fbgn_uniprot_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/collaborators/pmid_fbgn_uniprot_fb_2023_04.tsv
!(file-name pmid_fbgn_uniprot  data/ftp.flybase.net/releases/current/precomputed_files/collaborators/pmid_fbgn_uniprot_fb_2023_04.tsv)
(num-columns pmid_fbgn_uniprot 5)
(duplicated-rows pmid_fbgn_uniprot 0)
(total-rows pmid_fbgn_uniprot 2262948)
(unique-values pmid_fbgn_uniprot 1 57873 object)
(unique-values pmid_fbgn_uniprot 2 57872 int64)
(unique-values pmid_fbgn_uniprot 3 146121 object)
(unique-values pmid_fbgn_uniprot 4 2 object)
(unique-values pmid_fbgn_uniprot 5 184918 object)
(missing-values pmid_fbgn_uniprot 1 0 () ())
(missing-values pmid_fbgn_uniprot 2 0 () ())
(missing-values pmid_fbgn_uniprot 3 0 () ())
(missing-values pmid_fbgn_uniprot 4 0 () ())
(missing-values pmid_fbgn_uniprot 5 0 () ())
(most-frequent pmid_fbgn_uniprot 1 (# (# FBrf0244508 11253) (# FBrf0229340 12087) (# FBrf0210524 14897) (# FBrf0212295 20997) (# FBrf0210226 21057) (# FBrf0219727 27601) (# FBrf0200326 154679)))
(less-frequent pmid_fbgn_uniprot 1 (# (# FBrf0207593 1) (# FBrf0073396 1) (# FBrf0216372 1) (# FBrf0050713 1) (# FBrf0215265 1) (# FBrf0228014 1) (# FBrf0084265 1)))
(most-frequent pmid_fbgn_uniprot 2 (# (# 31722958 11253) (# 25312911 12087) (# 20371351 14897) (# 21074052 20997) (# 20220848 21057) (# 23071443 27601) (# 17994087 154679)))
(less-frequent pmid_fbgn_uniprot 2 (# (# 19226322 1) (# 21035367 1) (# 3938362 1) (# 7641726 1) (# 31992709 1) (# 2504633 1) (# 7924995 1)))
(most-frequent pmid_fbgn_uniprot 3 (# (# FBgn0003371 11920) (# FBgn0001624 12980) (# FBgn0264255 17080) (# FBgn0004647 18088) (# FBgn0033159 22357) (# FBgn0285944 22904) (# FBgn0003731 395427)))
(less-frequent pmid_fbgn_uniprot 3 (# (# FBgn0182483 1) (# FBgn0152605 1) (# FBgn0102225 1) (# FBgn0191710 1) (# FBgn0186768 1) (# FBgn0138504 1) (# FBgn0147962 1)))
(most-frequent pmid_fbgn_uniprot 4 (# (# "UniProt/Swiss-Prot" 394838) (# "UniProt/TrEMBL" 1868110)))
(less-frequent pmid_fbgn_uniprot 4 (# (# "UniProt/Swiss-Prot" 394838) (# "UniProt/TrEMBL" 1868110)))
(most-frequent pmid_fbgn_uniprot 5 (# (# Q7YSQ1 2584) (# Q7Z1J1 2584) (# Q7YSR5 2584) (# Q7YSU6 2584) (# M9NE67 2584) (# P10090 3804) (# P09615 4838)))
(less-frequent pmid_fbgn_uniprot 5 (# (# B4QI97 1) (# B4IFF0 1) (# B3MJC2 1) (# B4NVB3 1) (# A0A0Q9WJA5 1) (# B4H241 1) (# B3NEU8 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/automated_gene_summaries.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/automated_gene_summaries.tsv
!(file-name automated_gene_summaries  data/ftp.flybase.net/releases/current/precomputed_files/genes/automated_gene_summaries.tsv)
(num-columns automated_gene_summaries 2)
(duplicated-rows automated_gene_summaries 0)
(total-rows automated_gene_summaries 237237)
(unique-values automated_gene_summaries 1 237237 object)
(unique-values automated_gene_summaries 2 237237 object)
(missing-values automated_gene_summaries 1 0 () ())
(missing-values automated_gene_summaries 2 0 () ())
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/automated_gene_summaries_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/automated_gene_summaries_fb_2023_04.tsv
!(file-name automated_gene_summaries  data/ftp.flybase.net/releases/current/precomputed_files/genes/automated_gene_summaries_fb_2023_04.tsv)
(num-columns automated_gene_summaries 2)
(duplicated-rows automated_gene_summaries 0)
(total-rows automated_gene_summaries 237237)
(unique-values automated_gene_summaries 1 237237 object)
(unique-values automated_gene_summaries 2 237237 object)
(missing-values automated_gene_summaries 1 0 () ())
(missing-values automated_gene_summaries 2 0 () ())
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/best_gene_summary_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/best_gene_summary_fb_2023_04.tsv
!(file-name best_gene_summary  data/ftp.flybase.net/releases/current/precomputed_files/genes/best_gene_summary_fb_2023_04.tsv)
(num-columns best_gene_summary 4)
(duplicated-rows best_gene_summary 0)
(total-rows best_gene_summary 32142)
(unique-values best_gene_summary 1 32142 object)
(unique-values best_gene_summary 2 32142 object)
(unique-values best_gene_summary 3 5 object)
(unique-values best_gene_summary 4 29750 object)
(missing-values best_gene_summary 1 0 () ())
(missing-values best_gene_summary 2 0 () ())
(missing-values best_gene_summary 3 0 () ())
(null-value-count best_gene_summary 4 "" 21)
(missing-values best_gene_summary 4 21 (# "") (# 21))
(most-frequent best_gene_summary 3 (# (# "Interactive Fly" 64) (# UniProtKB 1737) (# "FlyBase Gene Snapshot" 3655) (# Alliance 8284) (# "FlyBase Auto Summary" 18402)))
(less-frequent best_gene_summary 3 (# (# "Interactive Fly" 64) (# UniProtKB 1737) (# "FlyBase Gene Snapshot" 3655) (# Alliance 8284) (# "FlyBase Auto Summary" 18402)))
(most-frequent best_gene_summary 4 (# (# "Predicted to enable chitin binding activity. Predicted to be located in extracellular region." 48) (# "Predicted to enable serine-type endopeptidase activity. Predicted to be involved in proteolysis." 56) (# "Is expressed in spermatozoon." 63) (# "Predicted to be involved in RNA processing. Predicted to be located in nucleolus." 72) (# "Predicted to be a structural constituent of ribosome. Predicted to be involved in translation. Predicted to be located in cytosolic ribosome." 96) (# "Is expressed in organism." 107) (# "Is expressed in adult head." 114)))
(less-frequent best_gene_summary 4 (# (# "The gene lethal (1) 291-68 is referred to in FlyBase by the symbol Dmel\\l(1)291-68 (FBgn0011177). It is a gene from Dmel. Gene has not been localized to the genome sequence. Its molecular function is unknown. The biological processes in which it is involved are not known. One allele is reported. No phenotypic data is available. The phenotypic class of allele includes: lethal." 1) (# "The gene E(csw)3B is referred to in FlyBase by the symbol Dmel\\E(csw)3B (FBgn0041256). It is a gene from Dmel. Gene has not been localized to the genome sequence. Its molecular function is described by: . The biological processes in which it is involved are not known. No alleles are reported." 1) (# "The gene E3 is referred to in FlyBase by the symbol Dmel\\E3 (FBgn0041255). It is a gene from Dmel. Gene has not been localized to the genome sequence. Its molecular function is unknown. The biological processes in which it is involved are not known. No alleles are reported." 1) (# "The gene H23-14 is referred to in FlyBase by the symbol Dmel\\H23-14 (FBgn0041211). It is a gene from Dmel. Gene has not been localized to the genome sequence. Its molecular function is unknown. The biological processes in which it is involved are not known. One allele is reported. No phenotypic data is available. The phenotypic class of allele includes: auxotroph." 1) (# "The gene Lipocalin is referred to in FlyBase by the symbol Dmel\\Lipocalin (FBgn0041202). It is a gene from Dmel. Gene has not been localized to the genome sequence. Its molecular function is unknown. The biological processes in which it is involved are not known. No alleles are reported." 1) (# "The gene prolyl-4-hydroxylase-a related protein is referred to in FlyBase by the symbol Dmel\\PH4\u03b1-RP (FBgn0041197). It is a gene from Dmel. Gene has not been localized to the genome sequence. Its molecular function is unknown. The biological processes in which it is involved are not known. No alleles are reported." 1) (# "The gene SSP6107 is referred to in FlyBase by the symbol Dmel\\SSP6107 (FBgn0041189). It is a gene from Dmel. Gene has not been localized to the genome sequence. Its molecular function is unknown. The biological processes in which it is involved are not known. No alleles are reported." 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/Dmel_enzyme_data_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/Dmel_enzyme_data_fb_2023_04.tsv
!(file-name Dmel_enzyme_data  data/ftp.flybase.net/releases/current/precomputed_files/genes/Dmel_enzyme_data_fb_2023_04.tsv)
(num-columns Dmel_enzyme_data 11)
(duplicated-rows Dmel_enzyme_data 0)
(total-rows Dmel_enzyme_data 3969)
(unique-values Dmel_enzyme_data 1 572 object)
(unique-values Dmel_enzyme_data 2 572 object)
(unique-values Dmel_enzyme_data 3 441 object)
(unique-values Dmel_enzyme_data 4 441 object)
(unique-values Dmel_enzyme_data 5 281 object)
(unique-values Dmel_enzyme_data 6 182 object)
(unique-values Dmel_enzyme_data 7 3736 object)
(unique-values Dmel_enzyme_data 8 3736 object)
(unique-values Dmel_enzyme_data 9 2454 object)
(unique-values Dmel_enzyme_data 10 860 object)
(unique-values Dmel_enzyme_data 11 860 object)
(missing-values Dmel_enzyme_data 1 0 () ())
(missing-values Dmel_enzyme_data 2 0 () ())
(missing-values Dmel_enzyme_data 3 0 () ())
(missing-values Dmel_enzyme_data 4 0 () ())
(null-value-count Dmel_enzyme_data 5 "" 1642)
(missing-values Dmel_enzyme_data 5 1642 (# "") (# 1642))
(null-value-count Dmel_enzyme_data 6 "" 2724)
(missing-values Dmel_enzyme_data 6 2724 (# "") (# 2724))
(missing-values Dmel_enzyme_data 7 0 () ())
(missing-values Dmel_enzyme_data 8 0 () ())
(null-value-count Dmel_enzyme_data 9 "" 1328)
(missing-values Dmel_enzyme_data 9 1328 (# "") (# 1328))
(null-value-count Dmel_enzyme_data 10 "" 1609)
(missing-values Dmel_enzyme_data 10 1609 (# "") (# 1609))
(null-value-count Dmel_enzyme_data 11 "" 1609)
(missing-values Dmel_enzyme_data 11 1609 (# "") (# 1609))
(most-frequent Dmel_enzyme_data 1 (# (# FBgg0001478 36) (# FBgg0001695 36) (# FBgg0001207 45) (# FBgg0001618 51) (# FBgg0001079 61) (# FBgg0000128 98) (# FBgg0001078 114)))
(less-frequent Dmel_enzyme_data 1 (# (# FBgg0001510 1) (# FBgg0001617 1) (# FBgg0001419 1) (# FBgg0001420 1) (# FBgg0001622 1) (# FBgg0001246 1) (# FBgg0000869 1)))
(most-frequent Dmel_enzyme_data 2 (# (# "UNCLASSIFIED RNA ENDONUCLEASES" 36) (# "CYTOCHROME P450 - CYP3 CLAN" 36) (# "UNCLASSIFIED NON-AMINOACYL ACYLTRANSFERASES" 45) (# "ECDYSTEROID KINASE-LIKE" 51) (# "S1A SERINE PROTEASES - CHYMOTRYPSIN-LIKE" 61) (# "UNCLASSIFIED RING DOMAIN UBIQUITIN LIGASES" 98) (# "S1A SERINE PROTEASES - TRYPSIN-LIKE" 114)))
(less-frequent Dmel_enzyme_data 2 (# (# TRANSGLUTAMINASES 1) (# "BETA-ALANYL-DOPAMINE/HISTAMINE HYDROLASES" 1) (# "SITE 2 PEPTIDASES" 1) (# "M76 METALLOENDOPEPTIDASES" 1) (# "EYA FAMILY PROTEIN TYROSINE PHOSPHATASES" 1) (# DEOXYCYTIDYLTRANSFERASES 1) (# "OXO-ACID-LYASES" 1)))
(most-frequent Dmel_enzyme_data 3 (# (# "GO:0004806" 55) (# "GO:0003724" 59) (# "GO:0004674" 90) (# "GO:0004497" 93) (# "GO:0003924" 146) (# "GO:0061630" 150) (# "GO:0004252" 205)))
(less-frequent Dmel_enzyme_data 3 (# (# "GO:0071566" 1) (# "GO:0003810" 1) (# "GO:0003923" 1) (# "GO:0016642" 1) (# "GO:0061863" 1) (# "GO:0008970" 1) (# "GO:0016872" 1)))
(most-frequent Dmel_enzyme_data 4 (# (# "triglyceride lipase activity" 55) (# "RNA helicase activity" 59) (# "protein serine/threonine kinase activity" 90) (# "monooxygenase activity" 93) (# "GTPase activity" 146) (# "ubiquitin protein ligase activity" 150) (# "serine-type endopeptidase activity" 205)))
(less-frequent Dmel_enzyme_data 4 (# (# "UFM1 activating enzyme activity" 1) (# "protein-glutamine gamma-glutamyltransferase activity" 1) (# "GPI-anchor transamidase activity" 1) (# "oxidoreductase activity, acting on the CH-NH2 group of donors, disulfide as acceptor" 1) (# "microtubule plus end polymerase" 1) (# "phospholipase A1 activity" 1) (# "intramolecular lyase activity" 1)))
(most-frequent Dmel_enzyme_data 5 (# (# "3.1.3.16" 47) (# "3.4.24.-" 47) (# "3.1.1.3" 55) (# "3.6.4.13" 59) (# "2.7.11.1" 90) (# "3.4.21.-" 209)))
(less-frequent Dmel_enzyme_data 5 (# (# "1.16.1.-" 1) (# "3.4.19.5" 1) (# "3.2.1.130" 1) (# "3.5.1.89" 1) (# "4.3.1.-|4.3.-.-" 1) (# "7.2.2.9" 1) (# "4.1.99.22" 1)))
(most-frequent Dmel_enzyme_data 6 (# (# "ubiquitinyl hydrolase 1" 36) (# "glutathione transferase" 38) (# "protein-serine/threonine phosphatase" 47) (# "triacylglycerol lipase" 55) (# "RNA helicase" 59) (# "non-specific serine/threonine protein kinase" 90)))
(less-frequent Dmel_enzyme_data 6 (# (# "ribonuclease T2" 1) (# "tripeptidyl-peptidase I|tripeptidyl-peptidase II" 1) (# "phospholipase A1" 1) (# "deoxyribonuclease II" 1) (# "N-acetylglucosamine-6-phosphate deacetylase" 1) (# "molybdopterin molybdotransferase" 1) (# "protoporphyrin ferrochelatase" 1)))
(most-frequent Dmel_enzyme_data 7 (# (# FBgn0028916 3) (# FBgn0002905 3) (# FBgn0030731 3) (# FBgn0011768 3) (# FBgn0034246 3) (# FBgn0263831 4) (# FBgn0010355 4)))
(less-frequent Dmel_enzyme_data 7 (# (# FBgn0025186 1) (# FBgn0043576 1) (# FBgn0043577 1) (# FBgn0043578 1) (# FBgn0029689 1) (# FBgn0037759 1) (# FBgn0027538 1)))
(most-frequent Dmel_enzyme_data 8 (# (# CG33090 3) (# PolQ 3) (# Mfe2 3) (# Fdh 3) (# "Dcr-2" 3) (# Gen 4) (# Taf1 4)))
(less-frequent Dmel_enzyme_data 8 (# (# "ari-2" 1) (# "PGRP-SC1a" 1) (# "PGRP-SB2" 1) (# "PGRP-SB1" 1) (# CG6428 1) (# CG8526 1) (# beta4GalNAcTA 1)))
(most-frequent Dmel_enzyme_data 9 (# (# rudimentary 3) (# "Trehalose-6-phosphate synthase 1" 3) (# "peroxisomal Multifunctional enzyme type 2" 3) (# sepia 3) (# "XPG-like endonuclease" 4) (# "TBP-associated factor 1" 4)))
(less-frequent Dmel_enzyme_data 9 (# (# "ariadne 2" 1) (# "Cardiolipin synthase" 1) (# "Sphingomyelin synthase related" 1) (# "Phosphatidylserine synthase" 1) (# "Pyruvate kinase" 1) (# "easily shocked" 1) (# fumble 1)))
(most-frequent Dmel_enzyme_data 10 (# (# "5.2.1.8" 33) (# "3.4.19.12" 36) (# "3.1.3.16" 38) (# "3.1.1.3" 51) (# "3.6.4.13" 54) (# "2.7.11.1" 104)))
(less-frequent Dmel_enzyme_data 10 (# (# "2.5.1.16" 1) (# "2.1.1.62" 1) (# "2.1.1.56" 1) (# "2.1.1.386" 1) (# "2.3.3.10" 1) (# "2.3.3.8" 1) (# "2.3.1.168" 1)))
(most-frequent Dmel_enzyme_data 11 (# (# "peptidylprolyl isomerase" 33) (# "ubiquitinyl hydrolase 1" 36) (# "protein-serine/threonine phosphatase" 38) (# "triacylglycerol lipase" 51) (# "RNA helicase" 54) (# "non-specific serine/threonine protein kinase" 104)))
(less-frequent Dmel_enzyme_data 11 (# (# "spermidine synthase" 1) (# "mRNA (2'-O-methyladenosine-N(6)-)-methyltransferase" 1) (# "mRNA (guanine-N(7))-methyltransferase" 1) (# "small RNA 2'-O-methyltransferase" 1) (# "hydroxymethylglutaryl-CoA synthase" 1) (# "ATP citrate synthase" 1) (# "dihydrolipoyllysine-residue (2-methylpropanoyl)transferase" 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/dmel_gene_sequence_ontology_annotations_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/dmel_gene_sequence_ontology_annotations_fb_2023_04.tsv
!(file-name dmel_gene_sequence_ontology_annotations  data/ftp.flybase.net/releases/current/precomputed_files/genes/dmel_gene_sequence_ontology_annotations_fb_2023_04.tsv)
(num-columns dmel_gene_sequence_ontology_annotations 4)
(duplicated-rows dmel_gene_sequence_ontology_annotations 0)
(total-rows dmel_gene_sequence_ontology_annotations 38590)
(unique-values dmel_gene_sequence_ontology_annotations 1 17902 object)
(unique-values dmel_gene_sequence_ontology_annotations 2 17902 object)
(unique-values dmel_gene_sequence_ontology_annotations 3 44 object)
(unique-values dmel_gene_sequence_ontology_annotations 4 44 object)
(missing-values dmel_gene_sequence_ontology_annotations 1 0 () ())
(missing-values dmel_gene_sequence_ontology_annotations 2 0 () ())
(missing-values dmel_gene_sequence_ontology_annotations 3 0 () ())
(missing-values dmel_gene_sequence_ontology_annotations 4 0 () ())
(most-frequent dmel_gene_sequence_ontology_annotations 1 (# (# FBgn0263102 5) (# FBgn0264308 5) (# FBgn0285944 5) (# FBgn0000448 5) (# FBgn0266019 5) (# FBgn0260866 5) (# FBgn0283521 5)))
(less-frequent dmel_gene_sequence_ontology_annotations 1 (# (# FBgn0000003 1) (# FBgn0085282 1) (# FBgn0085280 1) (# FBgn0085279 1) (# FBgn0085277 1) (# FBgn0085276 1) (# FBgn0085274 1)))
(most-frequent dmel_gene_sequence_ontology_annotations 2 (# (# psq 5) (# hbt 5) (# para 5) (# Hr3 5) (# rudhira 5) (# dnr1 5) (# lola 5)))
(less-frequent dmel_gene_sequence_ontology_annotations 2 (# (# "7SLRNA:CR32864" 1) (# CG34253 1) (# CG34251 1) (# CG34250 1) (# CG34248 1) (# CG34247 1) (# CG34245 1)))
(most-frequent dmel_gene_sequence_ontology_annotations 3 (# (# "gene_with_stop_codon_read_through" 402) (# "antisense_lncRNA_gene" 507) (# gene 767) (# "gene_with_edited_transcript" 810) (# "lncRNA_gene" 1996) (# "protein_coding_gene" 13986) (# "nuclear_gene" 17707)))
(less-frequent dmel_gene_sequence_ontology_annotations 3 (# (# "sbRNA_gene" 1) (# "SRP_RNA_gene" 1) (# "RNase_MRP_RNA_gene" 1) (# "RNase_P_RNA_gene" 1) (# "mt_SSU_rRNA_gene" 1) (# "mt_LSU_rRNA_gene" 1) (# "gene_with_recoded_mRNA" 2)))
(most-frequent dmel_gene_sequence_ontology_annotations 4 (# (# "SO:0000697" 402) (# "SO:0002182" 507) (# "SO:0000704" 767) (# "SO:0000548" 810) (# "SO:0002127" 1996) (# "SO:0001217" 13986) (# "SO:0000087" 17707)))
(less-frequent dmel_gene_sequence_ontology_annotations 4 (# (# "SO:0002353" 1) (# "SO:0001269" 1) (# "SO:0001640" 1) (# "SO:0001639" 1) (# "SO:0002365" 1) (# "SO:0002364" 1) (# "SO:0000693" 2)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/dmel_unique_protein_isoforms_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/dmel_unique_protein_isoforms_fb_2023_04.tsv
!(file-name dmel_unique_protein_isoforms  data/ftp.flybase.net/releases/current/precomputed_files/genes/dmel_unique_protein_isoforms_fb_2023_04.tsv)
(num-columns dmel_unique_protein_isoforms 4)
(duplicated-rows dmel_unique_protein_isoforms 0)
(total-rows dmel_unique_protein_isoforms 22452)
(unique-values dmel_unique_protein_isoforms 1 13986 object)
(unique-values dmel_unique_protein_isoforms 2 13986 object)
(unique-values dmel_unique_protein_isoforms 3 22452 object)
(unique-values dmel_unique_protein_isoforms 4 5633 object)
(missing-values dmel_unique_protein_isoforms 1 0 () ())
(missing-values dmel_unique_protein_isoforms 2 0 () ())
(missing-values dmel_unique_protein_isoforms 3 0 () ())
(null-value-count dmel_unique_protein_isoforms 4 "" 16820)
(missing-values dmel_unique_protein_isoforms 4 16820 (# "") (# 16820))
(most-frequent dmel_unique_protein_isoforms 1 (# (# FBgn0003429 23) (# FBgn0033504 25) (# FBgn0266696 25) (# FBgn0284408 25) (# FBgn0002781 31) (# FBgn0285944 57) (# FBgn0033159 75)))
(less-frequent dmel_unique_protein_isoforms 1 (# (# FBgn0000008 1) (# FBgn0038579 1) (# FBgn0038581 1) (# FBgn0038582 1) (# FBgn0038583 1) (# FBgn0038584 1) (# FBgn0038585 1)))
(most-frequent dmel_unique_protein_isoforms 2 (# (# slo 23) (# CAP 25) (# Svil 25) (# trol 25) (# "mod(mdg4)" 31) (# para 57) (# Dscam1 75)))
(less-frequent dmel_unique_protein_isoforms 2 (# (# a 1) (# CG14313 1) (# CG14314 1) (# CG7988 1) (# CG7183 1) (# mTerf5 1) (# Non3 1)))
(most-frequent dmel_unique_protein_isoforms 4 (# (# "Saf-B-PF" 1) (# "sosie-PC" 1) (# "Nct-PC" 1) (# "CG3744-PG" 1) (# "CG3744-PF" 1) (# "Not11-PC" 1)))
(less-frequent dmel_unique_protein_isoforms 4 (# (# "MAN1-PB,MAN1-PC" 1) (# "Nct-PC" 1) (# "sosie-PC" 1) (# "Saf-B-PF" 1) (# "Ude-PC,Ude-PD" 1) (# "CG5805-PB" 1) (# "atl-PB,atl-PC" 1)))
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_annotation_ID.tsv
!(file-name fbgn_annotation_ID  data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_annotation_ID.tsv)
(num-columns fbgn_annotation_ID 6)
(duplicated-rows fbgn_annotation_ID 0)
(total-rows fbgn_annotation_ID 17901)
(unique-values fbgn_annotation_ID 1 17901 object)
(unique-values fbgn_annotation_ID 2 1 object)
(unique-values fbgn_annotation_ID 3 17901 object)
(unique-values fbgn_annotation_ID 4 6498 object)
(unique-values fbgn_annotation_ID 5 17901 object)
(unique-values fbgn_annotation_ID 6 2214 object)
(missing-values fbgn_annotation_ID 1 0 () ())
(missing-values fbgn_annotation_ID 2 0 () ())
(missing-values fbgn_annotation_ID 3 0 () ())
(null-value-count fbgn_annotation_ID 4 "" 11059)
(missing-values fbgn_annotation_ID 4 11059 (# "") (# 11059))
(missing-values fbgn_annotation_ID 5 0 () ())
(null-value-count fbgn_annotation_ID 6 "" 15268)
(missing-values fbgn_annotation_ID 6 15268 (# "") (# 15268))
(most-frequent fbgn_annotation_ID 2 (# (# Dmel 17901)))
(less-frequent fbgn_annotation_ID 2 (# (# Dmel 17901)))
(most-frequent fbgn_annotation_ID 4 (# (# FBgn0031342 4) (# FBgn0034648 4) (# FBgn0037173 6) (# FBgn0003932 6) (# FBgn0052605 12) (# FBgn0002867 32)))
(less-frequent fbgn_annotation_ID 4 (# (# "FBgn0034701,FBgn0034702" 1) (# "FBgn0036269,FBgn0036270" 1) (# FBgn0062499 1) (# "FBgn0045834,FBgn0046807" 1) (# FBgn0060100 1) (# "FBgn0036185,FBgn0040818" 1) (# FBgn0036175 1)))
(most-frequent fbgn_annotation_ID 6 (# (# CG14398 4) (# CG15675 4) (# CG10450 4) (# CG14458 6) (# CG2149 6) (# CG32605 12)))
(less-frequent fbgn_annotation_ID 6 (# (# CG13505 1) (# "CG15275,CG15276,CG15277,CG33515" 1) (# "CG31537,CG2534" 1) (# "CG30111,CG5058" 1) (# "CG30164,CG30165,CG30166,CG4556" 1) (# "CG30179,CG30174,CG33149,CG3220" 1) (# CG14428 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_annotation_ID_fb_2023_04.pl



;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_annotation_ID_fb_2023_04.tsv
!(file-name fbgn_annotation_ID  data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_annotation_ID_fb_2023_04.tsv)
(num-columns fbgn_annotation_ID 6)
(duplicated-rows fbgn_annotation_ID 0)
(total-rows fbgn_annotation_ID 17901)
(unique-values fbgn_annotation_ID 1 17901 object)
(unique-values fbgn_annotation_ID 2 1 object)
(unique-values fbgn_annotation_ID 3 17901 object)
(unique-values fbgn_annotation_ID 4 6498 object)
(unique-values fbgn_annotation_ID 5 17901 object)
(unique-values fbgn_annotation_ID 6 2214 object)
(missing-values fbgn_annotation_ID 1 0 () ())
(missing-values fbgn_annotation_ID 2 0 () ())
(missing-values fbgn_annotation_ID 3 0 () ())
(null-value-count fbgn_annotation_ID 4 "" 11059)
(missing-values fbgn_annotation_ID 4 11059 (# "") (# 11059))
(missing-values fbgn_annotation_ID 5 0 () ())
(null-value-count fbgn_annotation_ID 6 "" 15268)
(missing-values fbgn_annotation_ID 6 15268 (# "") (# 15268))
(most-frequent fbgn_annotation_ID 2 (# (# Dmel 17901)))
(less-frequent fbgn_annotation_ID 2 (# (# Dmel 17901)))
(most-frequent fbgn_annotation_ID 4 (# (# FBgn0031342 4) (# FBgn0034648 4) (# FBgn0037173 6) (# FBgn0003932 6) (# FBgn0052605 12) (# FBgn0002867 32)))
(less-frequent fbgn_annotation_ID 4 (# (# "FBgn0034701,FBgn0034702" 1) (# "FBgn0036269,FBgn0036270" 1) (# FBgn0062499 1) (# "FBgn0045834,FBgn0046807" 1) (# FBgn0060100 1) (# "FBgn0036185,FBgn0040818" 1) (# FBgn0036175 1)))
(most-frequent fbgn_annotation_ID 6 (# (# CG14398 4) (# CG15675 4) (# CG10450 4) (# CG14458 6) (# CG2149 6) (# CG32605 12)))
(less-frequent fbgn_annotation_ID 6 (# (# CG13505 1) (# "CG15275,CG15276,CG15277,CG33515" 1) (# "CG31537,CG2534" 1) (# "CG30111,CG5058" 1) (# "CG30164,CG30165,CG30166,CG4556" 1) (# "CG30179,CG30174,CG33149,CG3220" 1) (# CG14428 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_exons2affy1_overlaps.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_exons2affy1_overlaps.tsv
!(file-name fbgn_exons2affy1_overlaps  data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_exons2affy1_overlaps.tsv)
(num-columns fbgn_exons2affy1_overlaps 30)
(duplicated-rows fbgn_exons2affy1_overlaps 0)
(total-rows fbgn_exons2affy1_overlaps 12082)
(unique-values fbgn_exons2affy1_overlaps 1 12082 object)
(unique-values fbgn_exons2affy1_overlaps 2 11598 object)
(unique-values fbgn_exons2affy1_overlaps 3 11576 object)
(unique-values fbgn_exons2affy1_overlaps 4 11569 object)
(unique-values fbgn_exons2affy1_overlaps 5 11538 object)
(unique-values fbgn_exons2affy1_overlaps 6 11509 object)
(unique-values fbgn_exons2affy1_overlaps 7 11474 object)
(unique-values fbgn_exons2affy1_overlaps 8 11449 object)
(unique-values fbgn_exons2affy1_overlaps 9 11414 object)
(unique-values fbgn_exons2affy1_overlaps 10 11387 object)
(unique-values fbgn_exons2affy1_overlaps 11 11345 object)
(unique-values fbgn_exons2affy1_overlaps 12 11314 object)
(unique-values fbgn_exons2affy1_overlaps 13 11244 object)
(unique-values fbgn_exons2affy1_overlaps 14 11171 object)
(unique-values fbgn_exons2affy1_overlaps 15 10830 object)
(unique-values fbgn_exons2affy1_overlaps 16 1808 object)
(unique-values fbgn_exons2affy1_overlaps 17 1555 object)
(unique-values fbgn_exons2affy1_overlaps 18 1450 object)
(unique-values fbgn_exons2affy1_overlaps 19 1358 object)
(unique-values fbgn_exons2affy1_overlaps 20 1308 object)
(unique-values fbgn_exons2affy1_overlaps 21 1258 object)
(unique-values fbgn_exons2affy1_overlaps 22 1213 object)
(unique-values fbgn_exons2affy1_overlaps 23 1183 object)
(unique-values fbgn_exons2affy1_overlaps 24 1139 object)
(unique-values fbgn_exons2affy1_overlaps 25 1102 object)
(unique-values fbgn_exons2affy1_overlaps 26 1058 object)
(unique-values fbgn_exons2affy1_overlaps 27 994 object)
(unique-values fbgn_exons2affy1_overlaps 28 922 object)
(unique-values fbgn_exons2affy1_overlaps 29 743 object)
(unique-values fbgn_exons2affy1_overlaps 30 34 object)
(missing-values fbgn_exons2affy1_overlaps 1 0 () ())
(missing-values fbgn_exons2affy1_overlaps 2 0 () ())
(null-value-count fbgn_exons2affy1_overlaps 3 "" 74)
(missing-values fbgn_exons2affy1_overlaps 3 74 (# "") (# 74))
(null-value-count fbgn_exons2affy1_overlaps 4 "" 105)
(missing-values fbgn_exons2affy1_overlaps 4 105 (# "") (# 105))
(null-value-count fbgn_exons2affy1_overlaps 5 "" 149)
(missing-values fbgn_exons2affy1_overlaps 5 149 (# "") (# 149))
(null-value-count fbgn_exons2affy1_overlaps 6 "" 184)
(missing-values fbgn_exons2affy1_overlaps 6 184 (# "") (# 184))
(null-value-count fbgn_exons2affy1_overlaps 7 "" 232)
(missing-values fbgn_exons2affy1_overlaps 7 232 (# "") (# 232))
(null-value-count fbgn_exons2affy1_overlaps 8 "" 265)
(missing-values fbgn_exons2affy1_overlaps 8 265 (# "") (# 265))
(null-value-count fbgn_exons2affy1_overlaps 9 "" 305)
(missing-values fbgn_exons2affy1_overlaps 9 305 (# "") (# 305))
(null-value-count fbgn_exons2affy1_overlaps 10 "" 341)
(missing-values fbgn_exons2affy1_overlaps 10 341 (# "") (# 341))
(null-value-count fbgn_exons2affy1_overlaps 11 "" 392)
(missing-values fbgn_exons2affy1_overlaps 11 392 (# "") (# 392))
(null-value-count fbgn_exons2affy1_overlaps 12 "" 425)
(missing-values fbgn_exons2affy1_overlaps 12 425 (# "") (# 425))
(null-value-count fbgn_exons2affy1_overlaps 13 "" 506)
(missing-values fbgn_exons2affy1_overlaps 13 506 (# "") (# 506))
(null-value-count fbgn_exons2affy1_overlaps 14 "" 587)
(missing-values fbgn_exons2affy1_overlaps 14 587 (# "") (# 587))
(null-value-count fbgn_exons2affy1_overlaps 15 "" 947)
(missing-values fbgn_exons2affy1_overlaps 15 947 (# "") (# 947))
(null-value-count fbgn_exons2affy1_overlaps 16 "" 10174)
(missing-values fbgn_exons2affy1_overlaps 16 10174 (# "") (# 10174))
(null-value-count fbgn_exons2affy1_overlaps 17 "" 10457)
(missing-values fbgn_exons2affy1_overlaps 17 10457 (# "") (# 10457))
(null-value-count fbgn_exons2affy1_overlaps 18 "" 10572)
(missing-values fbgn_exons2affy1_overlaps 18 10572 (# "") (# 10572))
(null-value-count fbgn_exons2affy1_overlaps 19 "" 10667)
(missing-values fbgn_exons2affy1_overlaps 19 10667 (# "") (# 10667))
(null-value-count fbgn_exons2affy1_overlaps 20 "" 10722)
(missing-values fbgn_exons2affy1_overlaps 20 10722 (# "") (# 10722))
(null-value-count fbgn_exons2affy1_overlaps 21 "" 10774)
(missing-values fbgn_exons2affy1_overlaps 21 10774 (# "") (# 10774))
(null-value-count fbgn_exons2affy1_overlaps 22 "" 10821)
(missing-values fbgn_exons2affy1_overlaps 22 10821 (# "") (# 10821))
(null-value-count fbgn_exons2affy1_overlaps 23 "" 10853)
(missing-values fbgn_exons2affy1_overlaps 23 10853 (# "") (# 10853))
(null-value-count fbgn_exons2affy1_overlaps 24 "" 10897)
(missing-values fbgn_exons2affy1_overlaps 24 10897 (# "") (# 10897))
(null-value-count fbgn_exons2affy1_overlaps 25 "" 10935)
(missing-values fbgn_exons2affy1_overlaps 25 10935 (# "") (# 10935))
(null-value-count fbgn_exons2affy1_overlaps 26 "" 10982)
(missing-values fbgn_exons2affy1_overlaps 26 10982 (# "") (# 10982))
(null-value-count fbgn_exons2affy1_overlaps 27 "" 11048)
(missing-values fbgn_exons2affy1_overlaps 27 11048 (# "") (# 11048))
(null-value-count fbgn_exons2affy1_overlaps 28 "" 11122)
(missing-values fbgn_exons2affy1_overlaps 28 11122 (# "") (# 11122))
(null-value-count fbgn_exons2affy1_overlaps 29 "" 11305)
(missing-values fbgn_exons2affy1_overlaps 29 11305 (# "") (# 11305))
(null-value-count fbgn_exons2affy1_overlaps 30 "" 12047)
(missing-values fbgn_exons2affy1_overlaps 30 12047 (# "") (# 12047))
(most-frequent fbgn_exons2affy1_overlaps 2 (# (# "151241_f_at_37" 4) (# "152093_at_1981" 4) (# "150941_f_at_119" 5) (# "151193_f_at_78" 6) (# "151224_f_at_40" 6) (# "150311_at_95" 7) (# "150941_f_at_115" 13)))
(less-frequent fbgn_exons2affy1_overlaps 2 (# (# "143052_at_1832" 1) (# "154468_at_260" 1) (# "152374_at_1177" 1) (# "151894_at_1465" 1) (# "154463_at_1950" 1) (# "154463_at_2378" 1) (# "154482_at_2296" 1)))
(most-frequent fbgn_exons2affy1_overlaps 3 (# (# "141538_at_2427" 3) (# "147260_at_95" 3) (# "155060_at_1425" 3) (# "152093_at_2013" 4) (# "151873_at_2152" 4) (# "150311_at_124" 7)))
(less-frequent fbgn_exons2affy1_overlaps 3 (# (# "143052_at_1816" 1) (# "149464_at_1100" 1) (# "142785_at_1174" 1) (# "142029_at_45" 1) (# "149466_at_2832" 1) (# "149467_at_1882" 1) (# "149468_at_757" 1)))
(most-frequent fbgn_exons2affy1_overlaps 4 (# (# "147260_at_80" 3) (# "147730_at_550" 3) (# "155060_at_1472" 3) (# "151873_at_2043" 4) (# "152093_at_2053" 4) (# "150311_at_247" 7)))
(less-frequent fbgn_exons2affy1_overlaps 4 (# (# "143052_at_1742" 1) (# "152622_at_824" 1) (# "149458_at_1158" 1) (# "149459_at_906" 1) (# "154507_at_1873" 1) (# "149463_at_2017" 1) (# "149464_at_1134" 1)))
(most-frequent fbgn_exons2affy1_overlaps 5 (# (# "147260_at_76" 3) (# "155060_at_1504" 3) (# "148466_at_864" 3) (# "151873_at_2023" 4) (# "152093_at_2081" 4) (# "150311_at_271" 7)))
(less-frequent fbgn_exons2affy1_overlaps 5 (# (# "143052_at_1727" 1) (# "154719_at_2453" 1) (# "141210_at_404" 1) (# "153896_at_1100" 1) (# "149435_at_300" 1) (# "149436_at_386" 1) (# "149441_at_1003" 1)))
(most-frequent fbgn_exons2affy1_overlaps 6 (# (# "142689_at_2404" 3) (# "151429_at_230" 3) (# "147260_at_69" 3) (# "152093_at_2097" 4) (# "151873_at_2014" 4) (# "150311_at_292" 7)))
(less-frequent fbgn_exons2affy1_overlaps 6 (# (# "143052_at_1717" 1) (# "151951_at_2428" 1) (# "154803_at_2317" 1) (# "149420_at_517" 1) (# "149421_at_366" 1) (# "154555_at_1035" 1) (# "154555_at_1375" 1)))
(most-frequent fbgn_exons2affy1_overlaps 7 (# (# "151429_at_248" 3) (# "141538_at_2265" 3) (# "155060_at_1543" 3) (# "151873_at_1834" 4) (# "152093_at_2142" 4) (# "150311_at_321" 7)))
(less-frequent fbgn_exons2affy1_overlaps 7 (# (# "143052_at_1703" 1) (# "154319_at_927" 1) (# "154993_at_1959" 1) (# "149402_at_2878" 1) (# "149403_at_625" 1) (# "149408_at_1010" 1) (# "149409_at_619" 1)))
(most-frequent fbgn_exons2affy1_overlaps 8 (# (# "151429_at_270" 3) (# "155060_at_1574" 3) (# "142689_at_2342" 3) (# "151873_at_1804" 4) (# "152093_at_2177" 4) (# "150311_at_350" 7)))
(less-frequent fbgn_exons2affy1_overlaps 8 (# (# "150941_f_at_115" 1) (# "142317_at_420" 1) (# "141883_at_323" 1) (# "149397_at_943" 1) (# "149398_at_568" 1) (# "152411_at_1798" 1) (# "149399_at_1928" 1)))
(most-frequent fbgn_exons2affy1_overlaps 9 (# (# "155060_at_1631" 3) (# "151429_at_293" 3) (# "147260_at_36" 3) (# "152093_at_2220" 4) (# "151873_at_1786" 4) (# "150311_at_358" 7)))
(less-frequent fbgn_exons2affy1_overlaps 9 (# (# "150941_f_at_113" 1) (# "149380_at_1052" 1) (# "149381_at_595" 1) (# "149382_at_343" 1) (# "149384_at_626" 1) (# "149385_at_909" 1) (# "149386_at_153" 1)))
(most-frequent fbgn_exons2affy1_overlaps 10 (# (# "142689_at_2195" 3) (# "147260_at_34" 3) (# "141538_at_2111" 3) (# "152093_at_2221" 4) (# "151873_at_1747" 4) (# "150311_at_405" 7)))
(less-frequent fbgn_exons2affy1_overlaps 10 (# (# "150941_f_at_111" 1) (# "149364_at_1814" 1) (# "149365_at_276" 1) (# "149368_at_173" 1) (# "149371_at_1969" 1) (# "149372_at_632" 1) (# "149374_at_1908" 1)))
(most-frequent fbgn_exons2affy1_overlaps 11 (# (# "151429_at_351" 3) (# "142689_at_2154" 3) (# "141538_at_2086" 3) (# "152093_at_2253" 4) (# "151873_at_1723" 4) (# "150311_at_406" 7)))
(less-frequent fbgn_exons2affy1_overlaps 11 (# (# "151224_f_at_40" 1) (# "149352_at_2845" 1) (# "155039_at_1822" 1) (# "149354_at_228" 1) (# "153107_at_1501" 1) (# "149355_at_446" 1) (# "152216_at_1907" 1)))
(most-frequent fbgn_exons2affy1_overlaps 12 (# (# "141538_at_2050" 3) (# "147260_at_29" 3) (# "151429_at_444" 3) (# "151873_at_1696" 4) (# "152093_at_2286" 4) (# "150311_at_428" 7)))
(less-frequent fbgn_exons2affy1_overlaps 12 (# (# "143052_at_1570" 1) (# "153297_at_1146" 1) (# "141292_at_956" 1) (# "155136_at_3280" 1) (# "151994_at_924" 1) (# "154820_at_469" 1) (# "152906_at_2090" 1)))
(most-frequent fbgn_exons2affy1_overlaps 13 (# (# "155060_at_1834" 3) (# "147260_at_27" 3) (# "142689_at_2057" 3) (# "151873_at_1681" 4) (# "152093_at_2365" 4) (# "150311_at_513" 7)))
(less-frequent fbgn_exons2affy1_overlaps 13 (# (# "143052_at_1561" 1) (# "149339_at_461" 1) (# "142566_at_6907" 1) (# "149340_at_389" 1) (# "149341_at_1305" 1) (# "149343_at_547" 1) (# "153316_at_970" 1)))
(most-frequent fbgn_exons2affy1_overlaps 14 (# (# "141538_at_1972" 3) (# "155060_at_1844" 3) (# "147260_at_21" 3) (# "152093_at_2369" 4) (# "151873_at_1656" 4) (# "150311_at_569" 7)))
(less-frequent fbgn_exons2affy1_overlaps 14 (# (# "143052_at_1547" 1) (# "153677_at_593" 1) (# "142725_at_3484" 1) (# "154418_at_2357" 1) (# "149337_at_1771" 1) (# "149338_at_114" 1) (# "153664_at_1123" 1)))
(most-frequent fbgn_exons2affy1_overlaps 15 (# (# "155060_at_1866" 3) (# "147260_at_19" 3) (# "141538_at_1905" 3) (# "151873_at_1630" 4) (# "152093_at_2425" 4) (# "150311_at_588" 7)))
(less-frequent fbgn_exons2affy1_overlaps 15 (# (# "143052_at_1488" 1) (# "142725_at_3437" 1) (# "154418_at_2421" 1) (# "149337_at_1722" 1) (# "149338_at_101" 1) (# "153664_at_1167" 1) (# "149339_at_383" 1)))
(most-frequent fbgn_exons2affy1_overlaps 16 (# (# "151193_f_at_66" 3) (# "151241_f_at_31" 5) (# "151193_f_at_70" 6) (# "151224_f_at_40" 7) (# "150941_f_at_119" 7) (# "150941_f_at_115" 7)))
(less-frequent fbgn_exons2affy1_overlaps 16 (# (# "143052_at_1399" 1) (# "154464_at_2230" 1) (# "152047_at_1146" 1) (# "150835_at_1439" 1) (# "154168_at_1052" 1) (# "153210_at_1520" 1) (# "150817_at_565" 1)))
(most-frequent fbgn_exons2affy1_overlaps 17 (# (# "142169_at_450" 2) (# "146155_at_129" 2) (# "152590_at_972" 2) (# "142115_at_370" 2) (# "143730_at_1670" 2) (# "150941_f_at_115" 9)))
(less-frequent fbgn_exons2affy1_overlaps 17 (# (# "143052_at_1395" 1) (# "151270_r_at_25" 1) (# "151257_at_31" 1) (# "151250_at_222" 1) (# "151229_at_145" 1) (# "151212_i_at_63" 1) (# "151207_r_at_79" 1)))
(most-frequent fbgn_exons2affy1_overlaps 18 (# (# "142667_at_1666" 2) (# "142844_at_1801" 2) (# "143730_at_1655" 2) (# "146200_at_740" 2) (# "145665_at_260" 2) (# "150941_f_at_113" 3)))
(less-frequent fbgn_exons2affy1_overlaps 18 (# (# "143052_at_1376" 1) (# "146970_at_795" 1) (# "142323_at_349" 1) (# "152548_at_1257" 1) (# "142085_at_360" 1) (# "151839_at_572" 1) (# "147900_at_1316" 1)))
(most-frequent fbgn_exons2affy1_overlaps 19 (# (# "141971_at_425" 2) (# "152590_at_890" 2) (# "150643_at_593" 2) (# "150117_at_272" 2) (# "146155_at_95" 2) (# "141331_at_764" 2)))
(less-frequent fbgn_exons2affy1_overlaps 19 (# (# "143052_at_1311" 1) (# "146844_at_45" 1) (# "152619_at_980" 1) (# "147717_at_296" 1) (# "141654_at_949" 1) (# "147704_at_309" 1) (# "151140_at_34" 1)))
(most-frequent fbgn_exons2affy1_overlaps 20 (# (# "152322_at_1081" 2) (# "150574_at_674" 2) (# "142012_at_515" 2) (# "150611_at_681" 2) (# "146094_at_3507" 2) (# "143040_at_1502" 2)))
(less-frequent fbgn_exons2affy1_overlaps 20 (# (# "141890_at_423" 1) (# "146741_at_332" 1) (# "146978_s_at_613" 1) (# "142001_r_at_17" 1) (# "152057_at_746" 1) (# "153061_at_3626" 1) (# "147846_at_517" 1)))
(most-frequent fbgn_exons2affy1_overlaps 21 (# (# "143730_at_1571" 2) (# "143071_at_199" 2) (# "153690_at_1496" 2) (# "146572_at_1248" 2) (# "151196_r_at_69" 2) (# "142734_at_582" 2)))
(less-frequent fbgn_exons2affy1_overlaps 21 (# (# "154290_at_1576" 1) (# "150536_at_1846" 1) (# "142057_at_306" 1) (# "149536_at_287" 1) (# "142647_at_483" 1) (# "152342_at_1443" 1) (# "150858_at_1203" 1)))
(most-frequent fbgn_exons2affy1_overlaps 22 (# (# "152828_at_1192" 2) (# "145513_at_1169" 2) (# "142641_at_1007" 2) (# "145665_at_185" 2) (# "145804_at_113" 2) (# "144663_at_167" 2)))
(less-frequent fbgn_exons2affy1_overlaps 22 (# (# "152590_at_807" 1) (# "150536_at_1823" 1) (# "142057_at_329" 1) (# "149536_at_257" 1) (# "142647_at_451" 1) (# "152342_at_1508" 1) (# "150858_at_1226" 1)))
(most-frequent fbgn_exons2affy1_overlaps 23 (# (# "145121_at_953" 2) (# "152828_at_1286" 2) (# "145513_at_1144" 2) (# "145665_at_164" 2) (# "145804_at_98" 2) (# "146744_at_188" 2)))
(less-frequent fbgn_exons2affy1_overlaps 23 (# (# "153298_at_1470" 1) (# "150321_at_1006" 1) (# "150383_at_2084" 1) (# "149454_at_1935" 1) (# "150142_at_1363" 1) (# "150536_at_1771" 1) (# "142057_at_344" 1)))
(most-frequent fbgn_exons2affy1_overlaps 24 (# (# "152828_at_1322" 2) (# "145513_at_1132" 2) (# "145665_at_155" 2) (# "145804_at_94" 2) (# "146094_at_3402" 2) (# "151831_at_920" 2)))
(less-frequent fbgn_exons2affy1_overlaps 24 (# (# "152253_at_1253" 1) (# "151549_i_at_495" 1) (# "142287_at_5287" 1) (# "150858_at_1274" 1) (# "152342_at_1587" 1) (# "142647_at_365" 1) (# "149536_at_82" 1)))
(most-frequent fbgn_exons2affy1_overlaps 25 (# (# "145121_at_1044" 2) (# "152828_at_1374" 2) (# "145513_at_1115" 2) (# "145665_at_112" 2) (# "145804_at_88" 2) (# "143367_at_1268" 2)))
(less-frequent fbgn_exons2affy1_overlaps 25 (# (# "152253_at_1277" 1) (# "152342_at_1612" 1) (# "142647_at_311" 1) (# "149536_at_79" 1) (# "142057_at_440" 1) (# "150536_at_1708" 1) (# "150142_at_1308" 1)))
(most-frequent fbgn_exons2affy1_overlaps 26 (# (# "142968_at_1016" 2) (# "147307_at_1054" 2) (# "152828_at_1410" 2) (# "145513_at_1081" 2) (# "145804_at_83" 2) (# "152030_at_2454" 2)))
(less-frequent fbgn_exons2affy1_overlaps 26 (# (# "151555_at_452" 1) (# "150321_at_786" 1) (# "149984_at_574" 1) (# "150288_at_440" 1) (# "154729_at_1256" 1) (# "150235_at_482" 1) (# "153559_at_1188" 1)))
(most-frequent fbgn_exons2affy1_overlaps 27 (# (# "142051_at_710" 2) (# "143071_at_395" 2) (# "153690_at_1701" 2) (# "152030_at_2472" 2) (# "148950_at_1101" 2) (# "146572_at_1489" 2)))
(less-frequent fbgn_exons2affy1_overlaps 27 (# (# "151555_at_477" 1) (# "143703_at_549" 1) (# "150198_at_145" 1) (# "153568_at_2595" 1) (# "153408_at_895" 1) (# "154631_at_2296" 1) (# "149802_at_35" 1)))
(most-frequent fbgn_exons2affy1_overlaps 28 (# (# "151831_at_1098" 2) (# "143071_at_435" 2) (# "142051_at_734" 2) (# "153690_at_1718" 2) (# "142946_at_186" 2) (# "148950_at_1027" 2)))
(less-frequent fbgn_exons2affy1_overlaps 28 (# (# "154840_at_235" 1) (# "149689_at_838" 1) (# "152285_at_955" 1) (# "151626_at_139" 1) (# "151157_at_129" 1) (# "151986_at_1676" 1) (# "149373_at_477" 1)))
(most-frequent fbgn_exons2affy1_overlaps 29 (# (# "143040_at_1070" 2) (# "148950_at_1005" 2) (# "152322_at_1333" 2) (# "142209_at_639" 2) (# "143367_at_1495" 2) (# "153005_at_1202" 2)))
(less-frequent fbgn_exons2affy1_overlaps 29 (# (# "154840_at_217" 1) (# "151546_i_at_74" 1) (# "145929_at_1640" 1) (# "151417_at_35" 1) (# "145917_at_142" 1) (# "154703_at_1319" 1) (# "145904_at_869" 1)))
(most-frequent fbgn_exons2affy1_overlaps 30 (# (# "151241_f_at_37" 1) (# "145456_at_322" 1) (# "142630_at_415" 1) (# "148015_at_1581" 1) (# "153230_at_2930" 2) (# "154681_at_1547" 2)))
(less-frequent fbgn_exons2affy1_overlaps 30 (# (# "153483_at_641" 1) (# "150941_f_at_90" 1) (# "144004_at_5787" 1) (# "144775_at_57" 1) (# "144816_at_1278" 1) (# "143155_at_2478" 1) (# "148015_at_1581" 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_exons2affy2_overlaps.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_exons2affy2_overlaps.tsv
!(file-name fbgn_exons2affy2_overlaps  data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_exons2affy2_overlaps.tsv)
(num-columns fbgn_exons2affy2_overlaps 14)
(duplicated-rows fbgn_exons2affy2_overlaps 4149)
(total-rows fbgn_exons2affy2_overlaps 12905)
(unique-values fbgn_exons2affy2_overlaps 1 8719 object)
(unique-values fbgn_exons2affy2_overlaps 2 1595 object)
(unique-values fbgn_exons2affy2_overlaps 3 1248 object)
(unique-values fbgn_exons2affy2_overlaps 4 1045 object)
(unique-values fbgn_exons2affy2_overlaps 5 922 object)
(unique-values fbgn_exons2affy2_overlaps 6 830 object)
(unique-values fbgn_exons2affy2_overlaps 7 752 object)
(unique-values fbgn_exons2affy2_overlaps 8 699 object)
(unique-values fbgn_exons2affy2_overlaps 9 639 object)
(unique-values fbgn_exons2affy2_overlaps 10 573 object)
(unique-values fbgn_exons2affy2_overlaps 11 508 object)
(unique-values fbgn_exons2affy2_overlaps 12 442 object)
(unique-values fbgn_exons2affy2_overlaps 13 358 object)
(unique-values fbgn_exons2affy2_overlaps 14 207 object)
(null-value-count fbgn_exons2affy2_overlaps 1 "" 3969)
(missing-values fbgn_exons2affy2_overlaps 1 3969 (# "") (# 3969))
(null-value-count fbgn_exons2affy2_overlaps 2 "" 11248)
(missing-values fbgn_exons2affy2_overlaps 2 11248 (# "") (# 11248))
(null-value-count fbgn_exons2affy2_overlaps 3 "" 11607)
(missing-values fbgn_exons2affy2_overlaps 3 11607 (# "") (# 11607))
(null-value-count fbgn_exons2affy2_overlaps 4 "" 11816)
(missing-values fbgn_exons2affy2_overlaps 4 11816 (# "") (# 11816))
(null-value-count fbgn_exons2affy2_overlaps 5 "" 11943)
(missing-values fbgn_exons2affy2_overlaps 5 11943 (# "") (# 11943))
(null-value-count fbgn_exons2affy2_overlaps 6 "" 12036)
(missing-values fbgn_exons2affy2_overlaps 6 12036 (# "") (# 12036))
(null-value-count fbgn_exons2affy2_overlaps 7 "" 12116)
(missing-values fbgn_exons2affy2_overlaps 7 12116 (# "") (# 12116))
(null-value-count fbgn_exons2affy2_overlaps 8 "" 12171)
(missing-values fbgn_exons2affy2_overlaps 8 12171 (# "") (# 12171))
(null-value-count fbgn_exons2affy2_overlaps 9 "" 12231)
(missing-values fbgn_exons2affy2_overlaps 9 12231 (# "") (# 12231))
(null-value-count fbgn_exons2affy2_overlaps 10 "" 12300)
(missing-values fbgn_exons2affy2_overlaps 10 12300 (# "") (# 12300))
(null-value-count fbgn_exons2affy2_overlaps 11 "" 12366)
(missing-values fbgn_exons2affy2_overlaps 11 12366 (# "") (# 12366))
(null-value-count fbgn_exons2affy2_overlaps 12 "" 12437)
(missing-values fbgn_exons2affy2_overlaps 12 12437 (# "") (# 12437))
(null-value-count fbgn_exons2affy2_overlaps 13 "" 12525)
(missing-values fbgn_exons2affy2_overlaps 13 12525 (# "") (# 12525))
(null-value-count fbgn_exons2affy2_overlaps 14 "" 12686)
(missing-values fbgn_exons2affy2_overlaps 14 12686 (# "") (# 12686))
(most-frequent fbgn_exons2affy2_overlaps 1 (# (# "1630536_at_1664" 3) (# "1633941_a_at_2332" 3) (# "1632394_s_at_2089" 3) (# "1625692_s_at_1888" 4) (# "1627164_at_3410" 4) (# "1625897_s_at_1066" 4)))
(less-frequent fbgn_exons2affy2_overlaps 1 (# (# "1637813_at_4186" 1) (# "1638283_at_2407" 1) (# "1639086_s_at_1819" 1) (# "1631434_at_334" 1) (# "1634855_s_at_1654" 1) (# "1636657_at_473" 1) (# "1641712_at_1957" 1)))
(most-frequent fbgn_exons2affy2_overlaps 2 (# (# "1635578_at_1116" 2) (# "1633941_a_at_2295" 3) (# "1631833_at_1721" 3) (# "1625692_s_at_1832" 4) (# "1635572_at_641" 4) (# "1625897_s_at_1127" 4)))
(less-frequent fbgn_exons2affy2_overlaps 2 (# (# "1636558_a_at_1881" 1) (# "1628490_at_857" 1) (# "1641656_at_713" 1) (# "1630618_at_2197" 1) (# "1625101_at_335" 1) (# "1635901_at_939" 1) (# "1631798_s_at_1021" 1)))
(most-frequent fbgn_exons2affy2_overlaps 3 (# (# "1631351_s_at_1022" 2) (# "1626491_at_1540" 2) (# "1635572_at_608" 3) (# "1633941_a_at_2232" 3) (# "1631833_at_1705" 3) (# "1625897_s_at_1142" 4)))
(less-frequent fbgn_exons2affy2_overlaps 3 (# (# "1636558_a_at_1850" 1) (# "1631522_x_at_66" 1) (# "1632440_at_286" 1) (# "1625460_s_at_89" 1) (# "1625783_at_502" 1) (# "1626735_at_200" 1) (# "1628502_at_164" 1)))
(most-frequent fbgn_exons2affy2_overlaps 4 (# (# "1632950_at_1094" 2) (# "1629590_at_807" 2) (# "1635578_at_1046" 2) (# "1635572_at_529" 3) (# "1631833_at_1657" 3) (# "1625897_s_at_1160" 4)))
(less-frequent fbgn_exons2affy2_overlaps 4 (# (# "1636558_a_at_1823" 1) (# "1629951_at_775" 1) (# "1627721_at_1681" 1) (# "1632946_at_1358" 1) (# "1630788_at_1473" 1) (# "1629262_at_502" 1) (# "1628625_at_1245" 1)))
(most-frequent fbgn_exons2affy2_overlaps 5 (# (# "1636445_at_196" 2) (# "1635578_at_1031" 2) (# "1634667_at_2047" 2) (# "1631833_at_1617" 3) (# "1635572_at_481" 3) (# "1625897_s_at_1229" 4)))
(less-frequent fbgn_exons2affy2_overlaps 5 (# (# "1636558_a_at_1742" 1) (# "1636314_at_387" 1) (# "1625214_at_592" 1) (# "1633462_at_1757" 1) (# "1638793_at_441" 1) (# "1630993_at_814" 1) (# "1637693_at_840" 1)))
(most-frequent fbgn_exons2affy2_overlaps 6 (# (# "1636445_at_205" 2) (# "1628766_at_1592" 2) (# "1627958_at_364" 2) (# "1631833_at_1553" 3) (# "1635572_at_448" 3) (# "1625897_s_at_1282" 4)))
(less-frequent fbgn_exons2affy2_overlaps 6 (# (# "1636558_a_at_1725" 1) (# "1629127_at_687" 1) (# "1632948_x_at_741" 1) (# "1631596_at_2406" 1) (# "1623590_s_at_2676" 1) (# "1638445_a_at_4372" 1) (# "1632739_at_505" 1)))
(most-frequent fbgn_exons2affy2_overlaps 7 (# (# "1627427_s_at_1090" 2) (# "1626491_at_1395" 2) (# "1634933_s_at_300" 2) (# "1635572_at_432" 3) (# "1631833_at_1528" 3) (# "1625897_s_at_1292" 4)))
(less-frequent fbgn_exons2affy2_overlaps 7 (# (# "1636558_a_at_1709" 1) (# "1625051_at_611" 1) (# "1634488_s_at_341" 1) (# "1630421_at_597" 1) (# "1628563_at_1739" 1) (# "1636412_at_2651" 1) (# "1634418_at_1457" 1)))
(most-frequent fbgn_exons2affy2_overlaps 8 (# (# "1627958_at_416" 2) (# "1626732_at_695" 2) (# "1626038_at_1253" 2) (# "1635572_at_393" 3) (# "1631833_at_1513" 3) (# "1625897_s_at_1337" 4)))
(less-frequent fbgn_exons2affy2_overlaps 8 (# (# "1636558_a_at_1571" 1) (# "1632338_a_at_1205" 1) (# "1641119_at_364" 1) (# "1627824_at_101" 1) (# "1632926_at_75" 1) (# "1631364_at_518" 1) (# "1639058_at_120" 1)))
(most-frequent fbgn_exons2affy2_overlaps 9 (# (# "1630406_at_385" 2) (# "1631351_s_at_947" 2) (# "1628766_at_1690" 2) (# "1631833_at_1487" 3) (# "1635572_at_378" 3) (# "1625897_s_at_1362" 4)))
(less-frequent fbgn_exons2affy2_overlaps 9 (# (# "1636558_a_at_1561" 1) (# "1632926_at_17" 1) (# "1631364_at_547" 1) (# "1639058_at_103" 1) (# "1628447_at_492" 1) (# "1626455_s_at_399" 1) (# "1638766_at_109" 1)))
(most-frequent fbgn_exons2affy2_overlaps 10 (# (# "1630406_at_337" 2) (# "1629590_at_1045" 2) (# "1633270_at_394" 2) (# "1631833_at_1469" 3) (# "1635572_at_297" 3) (# "1625897_s_at_1444" 4)))
(less-frequent fbgn_exons2affy2_overlaps 10 (# (# "1636558_a_at_1482" 1) (# "1635345_at_50" 1) (# "1634677_at_643" 1) (# "1635112_at_279" 1) (# "1641708_at_3032" 1) (# "1629586_at_1283" 1) (# "1640473_at_4678" 1)))
(most-frequent fbgn_exons2affy2_overlaps 11 (# (# "1632147_at_448" 2) (# "1629590_at_1085" 2) (# "1634176_a_at_438" 2) (# "1635572_at_234" 3) (# "1631833_at_1450" 3) (# "1625897_s_at_1488" 4)))
(less-frequent fbgn_exons2affy2_overlaps 11 (# (# "1636558_a_at_1425" 1) (# "1638214_at_467" 1) (# "1637070_at_754" 1) (# "1636893_at_55" 1) (# "1639804_at_1221" 1) (# "1628992_at_20" 1) (# "1627697_at_763" 1)))
(most-frequent fbgn_exons2affy2_overlaps 12 (# (# "1634933_s_at_139" 2) (# "1627958_at_512" 2) (# "1627427_s_at_891" 2) (# "1627339_at_219" 2) (# "1631833_at_1435" 3) (# "1635572_at_209" 3)))
(less-frequent fbgn_exons2affy2_overlaps 12 (# (# "1636558_a_at_1397" 1) (# "1638214_at_453" 1) (# "1637070_at_778" 1) (# "1636893_at_43" 1) (# "1639804_at_1258" 1) (# "1628992_at_17" 1) (# "1627697_at_738" 1)))
(most-frequent fbgn_exons2affy2_overlaps 13 (# (# "1634933_s_at_106" 2) (# "1632147_at_514" 2) (# "1633837_at_546" 2) (# "1627339_at_124" 2) (# "1631833_at_1404" 3) (# "1635572_at_157" 3)))
(less-frequent fbgn_exons2affy2_overlaps 13 (# (# "1636558_a_at_1379" 1) (# "1638214_at_432" 1) (# "1636893_at_32" 1) (# "1639804_at_1271" 1) (# "1628992_at_15" 1) (# "1627697_at_714" 1) (# "1635345_at_43" 1)))
(most-frequent fbgn_exons2affy2_overlaps 14 (# (# "1627339_at_73" 2) (# "1626491_at_1063" 2) (# "1634159_s_at_35" 2) (# "1626732_at_641" 2) (# "1631833_at_1383" 3) (# "1635572_at_129" 3)))
(less-frequent fbgn_exons2affy2_overlaps 14 (# (# "1636558_a_at_1365" 1) (# "1628563_at_1922" 1) (# "1636412_at_2551" 1) (# "1634418_at_1571" 1) (# "1632338_a_at_1456" 1) (# "1641119_at_581" 1) (# "1626455_s_at_584" 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_fbtr_fbpp_expanded_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_fbtr_fbpp_expanded_fb_2023_04.tsv
!(file-name fbgn_fbtr_fbpp_expanded  data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_fbtr_fbpp_expanded_fb_2023_04.tsv)
(num-columns fbgn_fbtr_fbpp_expanded 11)
(duplicated-rows fbgn_fbtr_fbpp_expanded 0)
(total-rows fbgn_fbtr_fbpp_expanded 35732)
(unique-values fbgn_fbtr_fbpp_expanded 1 1 object)
(unique-values fbgn_fbtr_fbpp_expanded 2 27 object)
(unique-values fbgn_fbtr_fbpp_expanded 3 17901 object)
(unique-values fbgn_fbtr_fbpp_expanded 4 17901 object)
(unique-values fbgn_fbtr_fbpp_expanded 5 11358 object)
(unique-values fbgn_fbtr_fbpp_expanded 6 17901 object)
(unique-values fbgn_fbtr_fbpp_expanded 7 9 object)
(unique-values fbgn_fbtr_fbpp_expanded 8 35732 object)
(unique-values fbgn_fbtr_fbpp_expanded 9 35732 object)
(unique-values fbgn_fbtr_fbpp_expanded 10 30803 object)
(unique-values fbgn_fbtr_fbpp_expanded 11 30803 object)
(missing-values fbgn_fbtr_fbpp_expanded 1 0 () ())
(missing-values fbgn_fbtr_fbpp_expanded 2 0 () ())
(missing-values fbgn_fbtr_fbpp_expanded 3 0 () ())
(missing-values fbgn_fbtr_fbpp_expanded 4 0 () ())
(null-value-count fbgn_fbtr_fbpp_expanded 5 "" 11174)
(missing-values fbgn_fbtr_fbpp_expanded 5 11174 (# "") (# 11174))
(missing-values fbgn_fbtr_fbpp_expanded 6 0 () ())
(missing-values fbgn_fbtr_fbpp_expanded 7 0 () ())
(missing-values fbgn_fbtr_fbpp_expanded 8 0 () ())
(missing-values fbgn_fbtr_fbpp_expanded 9 0 () ())
(null-value-count fbgn_fbtr_fbpp_expanded 10 "" 4930)
(missing-values fbgn_fbtr_fbpp_expanded 10 4930 (# "") (# 4930))
(null-value-count fbgn_fbtr_fbpp_expanded 11 "" 4930)
(missing-values fbgn_fbtr_fbpp_expanded 11 4930 (# "") (# 4930))
(most-frequent fbgn_fbtr_fbpp_expanded 1 (# (# Dmel 35732)))
(less-frequent fbgn_fbtr_fbpp_expanded 1 (# (# Dmel 35732)))
(most-frequent fbgn_fbtr_fbpp_expanded 2 (# (# "C_D_box_snoRNA_gene" 145) (# "tRNA_gene" 312) (# pseudogene 365) (# "antisense_lncRNA_gene" 621) (# "miRNA_gene" 747) (# "lncRNA_gene" 2374) (# "protein_coding_gene" 30802)))
(less-frequent fbgn_fbtr_fbpp_expanded 2 (# (# "sbRNA_gene" 1) (# "SRP_RNA_gene" 1) (# "mt_LSU_rRNA_gene" 1) (# "mt_SSU_rRNA_gene" 1) (# "RNase_MRP_RNA_gene" 1) (# "cytosolic_rRNA_28S_gene" 2) (# "RNA_7SK_gene" 2)))
(most-frequent fbgn_fbtr_fbpp_expanded 3 (# (# FBgn0011224 25) (# FBgn0284408 25) (# FBgn0033504 28) (# FBgn0266696 31) (# FBgn0002781 31) (# FBgn0285944 60) (# FBgn0033159 75)))
(less-frequent fbgn_fbtr_fbpp_expanded 3 (# (# FBgn0038809 1) (# FBgn0051812 1) (# FBgn0051815 1) (# FBgn0051816 1) (# FBgn0051822 1) (# FBgn0051823 1) (# FBgn0051824 1)))
(most-frequent fbgn_fbtr_fbpp_expanded 4 (# (# heph 25) (# trol 25) (# CAP 28) (# Svil 31) (# "mod(mdg4)" 31) (# para 60) (# Dscam1 75)))
(less-frequent fbgn_fbtr_fbpp_expanded 4 (# (# CG16953 1) (# Tsen2 1) (# CG31815 1) (# CG31816 1) (# CR31822 1) (# CG31823 1) (# CR31824 1)))
(most-frequent fbgn_fbtr_fbpp_expanded 5 (# (# hephaestus 25) (# CAP 28) (# "modifier of mdg4" 31) (# Supervillin 31) (# paralytic 60) (# "Down syndrome cell adhesion molecule 1" 75)))
(less-frequent fbgn_fbtr_fbpp_expanded 5 (# (# "long non-coding RNA:CR46535" 1) (# "Gustatory receptor 22e" 1) (# "long non-coding RNA:CR45471" 1) (# "Gustatory receptor 36a" 1) (# "Gustatory receptor 36b" 1) (# "Gustatory receptor 36c" 1) (# "Gustatory receptor 59a" 1)))
(most-frequent fbgn_fbtr_fbpp_expanded 6 (# (# CG31000 25) (# CG33950 25) (# CG18408 28) (# CG45186 31) (# CG32491 31) (# CG9907 60) (# CG17800 75)))
(less-frequent fbgn_fbtr_fbpp_expanded 6 (# (# CG16953 1) (# CG31812 1) (# CG31815 1) (# CG31816 1) (# CR31822 1) (# CG31823 1) (# CR31824 1)))
(most-frequent fbgn_fbtr_fbpp_expanded 7 (# (# "pre_miRNA" 262) (# snoRNA 300) (# tRNA 312) (# pseudogene 365) (# miRNA 485) (# ncRNA 3059) (# mRNA 30802)))
(less-frequent fbgn_fbtr_fbpp_expanded 7 (# (# snRNA 32) (# rRNA 115) (# "pre_miRNA" 262) (# snoRNA 300) (# tRNA 312) (# pseudogene 365) (# miRNA 485)))
(most-frequent fbgn_fbtr_fbpp_expanded 10 (# (# FBpp0309148 1) (# FBpp0074581 1) (# FBpp0290917 1) (# FBpp0308522 1) (# FBpp0304236 1) (# FBpp0071677 1)))
(less-frequent fbgn_fbtr_fbpp_expanded 10 (# (# FBpp0071677 1) (# FBpp0308522 1) (# FBpp0290917 1) (# FBpp0074581 1) (# FBpp0309148 1) (# FBpp0071045 1) (# FBpp0084559 1)))
(most-frequent fbgn_fbtr_fbpp_expanded 11 (# (# "p115-PB" 1) (# "meso18E-PA" 1) (# "meso18E-PB" 1) (# "meso18E-PC" 1) (# "rept-PB" 1) (# "a-PA" 1)))
(less-frequent fbgn_fbtr_fbpp_expanded 11 (# (# "a-PA" 1) (# "meso18E-PC" 1) (# "meso18E-PB" 1) (# "meso18E-PA" 1) (# "p115-PB" 1) (# "p115-PA" 1) (# "pins-PA" 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_fbtr_fbpp_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_fbtr_fbpp_fb_2023_04.tsv
!(file-name fbgn_fbtr_fbpp  data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_fbtr_fbpp_fb_2023_04.tsv)
(num-columns fbgn_fbtr_fbpp 3)
(duplicated-rows fbgn_fbtr_fbpp 0)
(total-rows fbgn_fbtr_fbpp 35732)
(unique-values fbgn_fbtr_fbpp 1 17901 object)
(unique-values fbgn_fbtr_fbpp 2 35732 object)
(unique-values fbgn_fbtr_fbpp 3 30803 object)
(missing-values fbgn_fbtr_fbpp 1 0 () ())
(missing-values fbgn_fbtr_fbpp 2 0 () ())
(null-value-count fbgn_fbtr_fbpp 3 "" 4930)
(missing-values fbgn_fbtr_fbpp 3 4930 (# "") (# 4930))
(most-frequent fbgn_fbtr_fbpp 1 (# (# FBgn0011224 25) (# FBgn0284408 25) (# FBgn0033504 28) (# FBgn0266696 31) (# FBgn0002781 31) (# FBgn0285944 60) (# FBgn0033159 75)))
(less-frequent fbgn_fbtr_fbpp 1 (# (# FBgn0038809 1) (# FBgn0051812 1) (# FBgn0051815 1) (# FBgn0051816 1) (# FBgn0051822 1) (# FBgn0051823 1) (# FBgn0051824 1)))
(most-frequent fbgn_fbtr_fbpp 3 (# (# FBpp0309148 1) (# FBpp0074581 1) (# FBpp0290917 1) (# FBpp0308522 1) (# FBpp0304236 1) (# FBpp0071677 1)))
(less-frequent fbgn_fbtr_fbpp 3 (# (# FBpp0071677 1) (# FBpp0308522 1) (# FBpp0290917 1) (# FBpp0074581 1) (# FBpp0309148 1) (# FBpp0071045 1) (# FBpp0084559 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_gleanr_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_gleanr_fb_2023_04.tsv
!(file-name fbgn_gleanr  data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_gleanr_fb_2023_04.tsv)
(num-columns fbgn_gleanr 4)
(duplicated-rows fbgn_gleanr 535)
(total-rows fbgn_gleanr 174893)
(unique-values fbgn_gleanr 1 11 object)
(unique-values fbgn_gleanr 2 174055 object)
(unique-values fbgn_gleanr 3 174055 object)
(unique-values fbgn_gleanr 4 174322 object)
(missing-values fbgn_gleanr 1 0 () ())
(missing-values fbgn_gleanr 2 0 () ())
(missing-values fbgn_gleanr 3 0 () ())
(missing-values fbgn_gleanr 4 0 () ())
(most-frequent fbgn_gleanr 1 (# (# Dere 15380) (# Dwil 15874) (# Dsim 16038) (# Dpse 16475) (# Dyak 16483) (# Dsec 16945) (# Dper 17373)))
(less-frequent fbgn_gleanr 1 (# (# Dvir 14755) (# Dmoj 14922) (# Dgri 15319) (# Dana 15329) (# Dere 15380) (# Dwil 15874) (# Dsim 16038)))
(most-frequent fbgn_gleanr 2 (# (# "Dpse\\GA30155" 4) (# "Dpse\\GA30065" 4) (# "Dpse\\GA30499" 4) (# "Dpse\\GA30462" 4) (# "Dpse\\GA30119" 5) (# "Dpse\\GA30479" 5) (# "Dpse\\GA30442" 11)))
(less-frequent fbgn_gleanr 2 (# (# "Dper\\GL22947" 1) (# "Dwil\\GK16453" 1) (# "Dwil\\GK11213" 1) (# "Dwil\\GK16551" 1) (# "Dwil\\GK11264" 1) (# "Dwil\\GK11214" 1) (# "Dwil\\GK11265" 1)))
(most-frequent fbgn_gleanr 3 (# (# FBgn0263057 4) (# FBgn0263238 4) (# FBgn0265036 4) (# FBgn0264756 4) (# FBgn0262499 5) (# FBgn0264773 5) (# FBgn0264579 11)))
(less-frequent fbgn_gleanr 3 (# (# FBgn0160537 1) (# FBgn0218455 1) (# FBgn0213224 1) (# FBgn0218553 1) (# FBgn0213275 1) (# FBgn0213225 1) (# FBgn0213276 1)))
(most-frequent fbgn_gleanr 4 (# (# "dgri_GLEANR_4274" 2) (# "dana_GLEANR_19894" 2) (# "dgri_GLEANR_7321" 2) (# "dgri_GLEANR_14174" 2) (# "dpse_GLEANR_5123" 3) (# "dpse_GLEANR_4701" 4) (# "dpse_GLEANR_8878" 4)))
(less-frequent fbgn_gleanr 4 (# (# "dsim_GLEANR_6342" 1) (# "dwil_GLEANR_16628" 1) (# "dwil_GLEANR_11555" 1) (# "dwil_GLEANR_11556" 1) (# "dwil_GLEANR_11460" 1) (# "dwil_GLEANR_11461" 1) (# "dwil_GLEANR_11557" 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_NAseq_Uniprot_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_NAseq_Uniprot_fb_2023_04.tsv
!(file-name fbgn_NAseq_Uniprot  data/ftp.flybase.net/releases/current/precomputed_files/genes/fbgn_NAseq_Uniprot_fb_2023_04.tsv)
(num-columns fbgn_NAseq_Uniprot 9)
(duplicated-rows fbgn_NAseq_Uniprot 0)
(total-rows fbgn_NAseq_Uniprot 1316132)
(unique-values fbgn_NAseq_Uniprot 1 214968 object)
(unique-values fbgn_NAseq_Uniprot 2 557 object)
(unique-values fbgn_NAseq_Uniprot 3 214968 object)
(unique-values fbgn_NAseq_Uniprot 4 762485 object)
(unique-values fbgn_NAseq_Uniprot 5 69341 object)
(unique-values fbgn_NAseq_Uniprot 6 193395 object)
(unique-values fbgn_NAseq_Uniprot 7 208900 object)
(unique-values fbgn_NAseq_Uniprot 8 34349 object)
(unique-values fbgn_NAseq_Uniprot 9 30241 object)
(missing-values fbgn_NAseq_Uniprot 1 0 () ())
(missing-values fbgn_NAseq_Uniprot 2 0 () ())
(missing-values fbgn_NAseq_Uniprot 3 0 () ())
(null-value-count fbgn_NAseq_Uniprot 4 "" 438122)
(missing-values fbgn_NAseq_Uniprot 4 438122 (# "") (# 438122))
(null-value-count fbgn_NAseq_Uniprot 5 "" 1246520)
(missing-values fbgn_NAseq_Uniprot 5 1246520 (# "") (# 1246520))
(null-value-count fbgn_NAseq_Uniprot 6 "" 1121258)
(missing-values fbgn_NAseq_Uniprot 6 1121258 (# "") (# 1121258))
(null-value-count fbgn_NAseq_Uniprot 7 "" 1107233)
(missing-values fbgn_NAseq_Uniprot 7 1107233 (# "") (# 1107233))
(null-value-count fbgn_NAseq_Uniprot 8 "" 1281783)
(missing-values fbgn_NAseq_Uniprot 8 1281783 (# "") (# 1281783))
(null-value-count fbgn_NAseq_Uniprot 9 "" 1285892)
(missing-values fbgn_NAseq_Uniprot 9 1285892 (# "") (# 1285892))
(most-frequent fbgn_NAseq_Uniprot 1 (# (# sta 1332) (# RpL5 1362) (# alphaTub84B 1442) (# "Hsc70-4" 1611) (# ninaE 1699) (# eEF2 2370) (# eEF1alpha1 2383)))
(less-frequent fbgn_NAseq_Uniprot 1 (# (# "Hsap\\FSBP" 1) (# "Dyak\\GE14653" 1) (# "Dyak\\GE14652" 1) (# "Dere\\GG16178" 1) (# "Dyak\\GE14651" 1) (# "Dyak\\GE14650" 1) (# "Dyak\\GE14649" 1)))
(most-frequent fbgn_NAseq_Uniprot 2 (# (# Dper 34397) (# Dmoj 34929) (# Dvir 35196) (# Dsim 37463) (# Dana 38929) (# Dyak 39546) (# Dmel 938032)))
(less-frequent fbgn_NAseq_Uniprot 2 (# (# Cpac 1) (# Hvul 1) (# Zghe 1) (# Dhye 1) (# Dabu 1) (# Xlae 1) (# Cfum 1)))
(most-frequent fbgn_NAseq_Uniprot 3 (# (# FBgn0003517 1332) (# FBgn0064225 1362) (# FBgn0003884 1442) (# FBgn0266599 1611) (# FBgn0002940 1699) (# FBgn0000559 2370) (# FBgn0284245 2383)))
(less-frequent fbgn_NAseq_Uniprot 3 (# (# FBgn0289485 1) (# FBgn0232248 1) (# FBgn0232247 1) (# FBgn0108413 1) (# FBgn0232246 1) (# FBgn0232245 1) (# FBgn0232244 1)))
(most-frequent fbgn_NAseq_Uniprot 4 (# (# CH379071 439) (# AE014298 5350) (# AE014134 5651) (# AE014296 5875) (# AE013599 6054) (# AE014297 7206)))
(less-frequent fbgn_NAseq_Uniprot 4 (# (# J01122 1) (# GH739917 1) (# GH740238 1) (# GH740504 1) (# GH740582 1) (# GH740722 1) (# GH741128 1)))
(most-frequent fbgn_NAseq_Uniprot 5 (# (# AAA28968 9) (# CAA38960 9) (# AAA28969 9) (# AAA28966 9) (# AAC47002 9) (# AAA28425 10)))
(less-frequent fbgn_NAseq_Uniprot 5 (# (# AFH08132 1) (# AAG22409 1) (# AAL28803 1) (# AAL57756 1) (# AAF46261 1) (# AAF46262 1) (# AAM29624 1)))
(most-frequent fbgn_NAseq_Uniprot 6 (# (# P02283 24) (# P84052 31) (# Q76FD7 40) (# Q76FE2 47) (# Q76N00 50) (# Q76FD9 65)))
(less-frequent fbgn_NAseq_Uniprot 6 (# (# A1ZAK1 1) (# B4R037 1) (# B4R038 1) (# B4R040 1) (# B4R043 1) (# B4R044 1) (# B4R047 1)))
(most-frequent fbgn_NAseq_Uniprot 7 (# (# 6632090.0 1) (# 6627682.0 1) (# 6631334.0 1) (# 6631316.0 1) (# 6634144.0 1) (# 6624472.0 1)))
(less-frequent fbgn_NAseq_Uniprot 7 (# (# 6611558.0 1) (# 6634144.0 1) (# 6631316.0 1) (# 6631334.0 1) (# 6627682.0 1) (# 6632090.0 1) (# 6632175.0 1)))
(most-frequent fbgn_NAseq_Uniprot 8 (# (# "NM_168111" 1) (# "NM_168136" 1) (# "NM_168145" 1) (# "NM_168144" 1) (# "NM_001169879" 1) (# "NM_134950" 2)))
(less-frequent fbgn_NAseq_Uniprot 8 (# (# "NM_141332" 1) (# "NM_001274510" 1) (# "NM_001274509" 1) (# "NM_001259707" 1) (# "NM_001169879" 1) (# "NM_168112" 1) (# "NM_168113" 1)))
(most-frequent fbgn_NAseq_Uniprot 9 (# (# "NP_001137539" 1) (# "NP_001287647" 1) (# "NP_001287648" 1) (# "NP_001104474" 1) (# "NP_001188370" 1) (# "NP_001287646" 1)))
(less-frequent fbgn_NAseq_Uniprot 9 (# (# "NP_648102" 1) (# "NP_001287648" 1) (# "NP_001287647" 1) (# "NP_001137539" 1) (# "NP_001104473" 1) (# "NP_001104472" 1) (# "NP_001104471" 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_functional_complementation_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_functional_complementation_fb_2023_04.tsv
!(file-name gene_functional_complementation  data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_functional_complementation_fb_2023_04.tsv)
(num-columns gene_functional_complementation 5)
(duplicated-rows gene_functional_complementation 0)
(total-rows gene_functional_complementation 463)
(unique-values gene_functional_complementation 1 319 object)
(unique-values gene_functional_complementation 2 319 object)
(unique-values gene_functional_complementation 3 376 object)
(unique-values gene_functional_complementation 4 376 object)
(unique-values gene_functional_complementation 5 392 object)
(missing-values gene_functional_complementation 1 0 () ())
(missing-values gene_functional_complementation 2 0 () ())
(missing-values gene_functional_complementation 3 0 () ())
(missing-values gene_functional_complementation 4 0 () ())
(missing-values gene_functional_complementation 5 0 () ())
(most-frequent gene_functional_complementation 1 (# (# Lrrk 5) (# Marf 5) (# Pink1 5) (# oc 7) (# Nrg 7) (# cpx 8) (# TBPH 8)))
(less-frequent gene_functional_complementation 1 (# (# ATP6AP2 1) (# ci 1) (# cindr 1) (# clu 1) (# cn 1) (# cpa 1) (# csw 1)))
(most-frequent gene_functional_complementation 2 (# (# FBgn0038816 5) (# FBgn0029870 5) (# FBgn0029891 5) (# FBgn0004102 7) (# FBgn0264975 7) (# FBgn0041605 8) (# FBgn0025790 8)))
(less-frequent gene_functional_complementation 2 (# (# FBgn0037671 1) (# FBgn0004859 1) (# FBgn0027598 1) (# FBgn0034087 1) (# FBgn0000337 1) (# FBgn0034577 1) (# FBgn0000382 1)))
(most-frequent gene_functional_complementation 3 (# (# "Hsap\\MFN2" 4) (# "Hsap\\SOD1" 4) (# "Hsap\\L1CAM" 4) (# "Hsap\\PARK7" 4) (# "Hsap\\PINK1" 5) (# "Hsap\\LRRK2" 5) (# "Hsap\\TARDBP" 7)))
(less-frequent gene_functional_complementation 3 (# (# "Hsap\\ATP6AP2" 1) (# "Hsap\\EIF4A2" 1) (# "Hsap\\DROSHA" 1) (# "Hsap\\GRAP" 1) (# "Hsap\\SUPT16H" 1) (# "Hsap\\SRCAP" 1) (# "Hsap\\PIN1" 1)))
(most-frequent gene_functional_complementation 4 (# (# FBgn0265221 4) (# FBgn0024960 4) (# FBgn0026071 4) (# FBgn0086735 4) (# FBgn0086479 5) (# FBgn0262113 5) (# FBgn0261084 7)))
(less-frequent gene_functional_complementation 4 (# (# FBgn0262153 1) (# FBgn0289163 1) (# FBgn0289120 1) (# FBgn0286886 1) (# FBgn0289345 1) (# FBgn0283711 1) (# FBgn0288530 1)))
(most-frequent gene_functional_complementation 5 (# (# FBrf0216943 3) (# FBrf0210782 3) (# FBrf0146918 3) (# FBrf0242427 3) (# FBrf0184161 4) (# FBrf0252066 4) (# FBrf0212111 4)))
(less-frequent gene_functional_complementation 5 (# (# FBrf0211368 1) (# FBrf0101988 1) (# FBrf0193931 1) (# FBrf0227402 1) (# FBrf0230449 1) (# FBrf0188025 1) (# FBrf0174932 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_genetic_interactions_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_genetic_interactions_fb_2023_04.tsv
!(file-name gene_genetic_interactions  data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_genetic_interactions_fb_2023_04.tsv)
(num-columns gene_genetic_interactions 6)
(duplicated-rows gene_genetic_interactions 0)
(total-rows gene_genetic_interactions 20321)
(unique-values gene_genetic_interactions 1 2958 object)
(unique-values gene_genetic_interactions 2 2958 object)
(unique-values gene_genetic_interactions 3 4615 object)
(unique-values gene_genetic_interactions 4 4615 object)
(unique-values gene_genetic_interactions 5 2 object)
(unique-values gene_genetic_interactions 6 5428 object)
(missing-values gene_genetic_interactions 1 0 () ())
(missing-values gene_genetic_interactions 2 0 () ())
(missing-values gene_genetic_interactions 3 0 () ())
(missing-values gene_genetic_interactions 4 0 () ())
(missing-values gene_genetic_interactions 5 0 () ())
(missing-values gene_genetic_interactions 6 0 () ())
(most-frequent gene_genetic_interactions 1 (# (# Egfr 168) (# pbl 173) (# H 173) (# pnr 174) (# w 181) (# Ras85D 365) (# N 384)))
(less-frequent gene_genetic_interactions 1 (# (# Fit1 1) (# Gtpx 1) (# "kat-60L1" 1) (# "Abl|fax" 1) (# "rpr|hid" 1) (# Gfrl 1) (# "mod(mdg4)|sc" 1)))
(most-frequent gene_genetic_interactions 2 (# (# FBgn0003731 168) (# FBgn0003041 173) (# FBgn0001169 173) (# FBgn0003117 174) (# FBgn0003996 181) (# FBgn0003205 365) (# FBgn0004647 384)))
(less-frequent gene_genetic_interactions 2 (# (# FBgn0035498 1) (# FBgn0035438 1) (# FBgn0037375 1) (# "FBgn0000017|FBgn0014163" 1) (# "FBgn0011706|FBgn0003997" 1) (# FBgn0262869 1) (# "FBgn0002781|FBgn0004170" 1)))
(most-frequent gene_genetic_interactions 3 (# (# wg 110) (# puc 117) (# Ras85D 141) (# Egfr 158) (# Diap1 163) (# N 174) (# bsk 181)))
(less-frequent gene_genetic_interactions 3 (# (# "Su(tor)278-22" 1) (# CG32982 1) (# CG15599 1) (# "Su(E1)-A" 1) (# "mir-13b-2" 1) (# EP1095 1) (# "S(Sev-CycE)D28" 1)))
(most-frequent gene_genetic_interactions 4 (# (# FBgn0284084 110) (# FBgn0243512 117) (# FBgn0003205 141) (# FBgn0003731 158) (# FBgn0260635 163) (# FBgn0004647 174) (# FBgn0000229 181)))
(less-frequent gene_genetic_interactions 4 (# (# FBgn0026335 1) (# FBgn0052982 1) (# FBgn0030667 1) (# FBgn0262767 1) (# FBgn0262421 1) (# FBgn0062701 1) (# FBgn0041783 1)))
(most-frequent gene_genetic_interactions 5 (# (# enhanceable 7874) (# suppressible 12447)))
(less-frequent gene_genetic_interactions 5 (# (# enhanceable 7874) (# suppressible 12447)))
(most-frequent gene_genetic_interactions 6 (# (# FBrf0190765 83) (# FBrf0188528 88) (# FBrf0190751 89) (# FBrf0187664 105) (# FBrf0147055 149) (# FBrf0199094 151) (# FBrf0241270 160)))
(less-frequent gene_genetic_interactions 6 (# (# FBrf0221584 1) (# FBrf0231072 1) (# FBrf0102734 1) (# FBrf0190193 1) (# FBrf0229219 1) (# FBrf0226148 1) (# FBrf0208690 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_groups_HGNC_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_groups_HGNC_fb_2023_04.tsv
!(file-name gene_groups_HGNC  data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_groups_HGNC_fb_2023_04.tsv)
(num-columns gene_groups_HGNC 4)
(duplicated-rows gene_groups_HGNC 0)
(total-rows gene_groups_HGNC 1711)
(unique-values gene_groups_HGNC 1 1699 object)
(unique-values gene_groups_HGNC 2 1699 object)
(unique-values gene_groups_HGNC 3 1699 object)
(unique-values gene_groups_HGNC 4 506 object)
(missing-values gene_groups_HGNC 1 0 () ())
(missing-values gene_groups_HGNC 2 0 () ())
(missing-values gene_groups_HGNC 3 0 () ())
(null-value-count gene_groups_HGNC 4 "" 1192)
(missing-values gene_groups_HGNC 4 1192 (# "") (# 1192))
(most-frequent gene_groups_HGNC 1 (# (# FBgg0000526 2) (# FBgg0000112 2) (# FBgg0000738 2) (# FBgg0000588 2) (# FBgg0000792 2) (# FBgg0000083 3) (# FBgg0000279 3)))
(less-frequent gene_groups_HGNC 1 (# (# FBgg0000451 1) (# FBgg0000651 1) (# FBgg0001307 1) (# FBgg0000697 1) (# FBgg0000072 1) (# FBgg0000437 1) (# FBgg0001352 1)))
(most-frequent gene_groups_HGNC 2 (# (# SM 2) (# INX 2) (# PRDTF 2) (# "CAC-U" 2) (# E2FTF 2) (# SYT 3) (# "RPD3-HDA1" 3)))
(less-frequent gene_groups_HGNC 2 (# (# "TRNA-C-THR-CGT" 1) (# NAT 1) (# APAS 1) (# SLC33 1) (# ADAM 1) (# "TRNA-C-LEU-TAA" 1) (# "N-GH" 1)))
(most-frequent gene_groups_HGNC 3 (# (# "SPLICEOSOMAL SM PROTEINS" 2) (# INNEXINS 2) (# "PAIRED TRANSCRIPTION FACTORS" 2) (# "UNCLASSIFIED CALCIUM CHANNEL-FORMING SUBUNITS" 2) (# "E2F TRANSCRIPTION FACTORS" 2) (# "SYNAPTOTAGMINS & SYNAPTOTAGMIN-LIKE PROTEINS" 3) (# "RPD3/HDA1 LYSINE DEACETYLASES" 3)))
(less-frequent gene_groups_HGNC 3 (# (# "CYTOSOLIC THREONINE-CGT TRANSFER RNAS" 1) (# "N-TERMINAL ACETYLTRANSFERASE CATALYTIC SUBUNITS" 1) (# ASPARAGINASES 1) (# "SLC33 ACETYL-COA TRANSPORTERS" 1) (# "ADAM METALLOPROTEASES" 1) (# "CYTOSOLIC LEUCINE-TAA TRANSFER RNAS" 1) (# "N-GLYCOSYL HYDROLASES" 1)))
(most-frequent gene_groups_HGNC 4 (# (# 1281.0 2) (# 363.0 2) (# 434.0 2) (# 816.0 2) (# 1254.0 2) (# 669.0 2)))
(less-frequent gene_groups_HGNC 4 (# (# 346.0 1) (# 1654.0 1) (# 1585.0 1) (# 1419.0 1) (# 2154.0 1) (# 262.0 1) (# 1027.0 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_group_data_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_group_data_fb_2023_04.tsv
!(file-name gene_group_data  data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_group_data_fb_2023_04.tsv)
(num-columns gene_group_data 7)
(duplicated-rows gene_group_data 0)
(total-rows gene_group_data 10957)
(unique-values gene_group_data 1 1629 object)
(unique-values gene_group_data 2 1629 object)
(unique-values gene_group_data 3 1629 object)
(unique-values gene_group_data 4 389 object)
(unique-values gene_group_data 5 389 object)
(unique-values gene_group_data 6 8251 object)
(unique-values gene_group_data 7 8251 object)
(missing-values gene_group_data 1 0 () ())
(missing-values gene_group_data 2 0 () ())
(missing-values gene_group_data 3 0 () ())
(null-value-count gene_group_data 4 "" 1106)
(missing-values gene_group_data 4 1106 (# "") (# 1106))
(null-value-count gene_group_data 5 "" 1106)
(missing-values gene_group_data 5 1106 (# "") (# 1106))
(null-value-count gene_group_data 6 "" 405)
(missing-values gene_group_data 6 405 (# "") (# 405))
(null-value-count gene_group_data 7 "" 405)
(missing-values gene_group_data 7 405 (# "") (# 405))
(most-frequent gene_group_data 1 (# (# FBgg0000128 98) (# FBgg0001176 105) (# FBgg0001186 106) (# FBgg0001078 114) (# FBgg0000097 120) (# FBgg0001077 136) (# FBgg0000732 272)))
(less-frequent gene_group_data 1 (# (# FBgg0001756 1) (# FBgg0000834 1) (# FBgg0001677 1) (# FBgg0000396 1) (# FBgg0000921 1) (# FBgg0000512 1) (# FBgg0000662 1)))
(most-frequent gene_group_data 2 (# (# "E3-RING-U" 98) (# CPR 105) (# CBD 106) (# "SP-T" 114) (# OR 120) (# "S1A-NPH" 136) (# "ZF-C2H2" 272)))
(less-frequent gene_group_data 2 (# (# UFM1 1) (# GH47 1) (# GH99 1) (# "TRNA-C-ASP" 1) (# MDH 1) (# KCN 1) (# SLC7 1)))
(most-frequent gene_group_data 3 (# (# "UNCLASSIFIED RING DOMAIN UBIQUITIN LIGASES" 98) (# "CPR CUTICLE PROTEIN FAMILY" 105) (# "CHITIN BINDING DOMAIN-CONTAINING PROTEINS" 106) (# "S1A SERINE PROTEASES - TRYPSIN-LIKE" 114) (# "ODORANT RECEPTORS" 120) (# "S1A NON-PEPTIDASE HOMOLOGS" 136) (# "C2H2 ZINC FINGER TRANSCRIPTION FACTORS" 272)))
(less-frequent gene_group_data 3 (# (# "UFM1 PROTEINS" 1) (# "CLASS I ALPHA-MANNOSIDASES" 1) (# "ENDO-ALPHA MANNOSIDASES" 1) (# "CYTOSOLIC ASPARTIC ACID TRANSFER RNAS" 1) (# "MALATE DEHYDROGENASES" 1) (# "POTASSIUM CHANNEL SUBUNITS" 1) (# "SLC7 FAMILY OF AMINO ACID TRANSPORTERS" 1)))
(most-frequent gene_group_data 4 (# (# FBgg0001178 162) (# FBgg0001841 178) (# FBgg0001076 190) (# FBgg0000729 277) (# FBgg0000537 318) (# FBgg0000686 392)))
(less-frequent gene_group_data 4 (# (# FBgg0001357 1) (# FBgg0000408 1) (# FBgg0001039 1) (# FBgg0001844 2) (# FBgg0001637 2) (# FBgg0000582 2) (# FBgg0000130 2)))
(most-frequent gene_group_data 5 (# (# CP 162) (# "OXPHOS-V" 178) (# S1AP 190) (# "ZN-TF" 277) (# "SPL-INT" 318) (# SLC 392)))
(less-frequent gene_group_data 5 (# (# ETH 1) (# "TRNA-C-SEC" 1) (# OXRPX 1) (# "PSM-G" 2) (# LADAC 2) (# IC 2) (# RP 2)))
(most-frequent gene_group_data 6 (# (# FBgn0261933 10) (# FBgn0000426 13) (# FBgn0261790 13) (# FBgn0261791 13) (# FBgn0023167 13) (# FBgn0262601 13)))
(less-frequent gene_group_data 6 (# (# FBgn0002565 1) (# FBgn0052671 1) (# FBgn0262518 1) (# FBgn0037364 1) (# FBgn0005586 1) (# FBgn0015791 1) (# FBgn0015795 1)))
(most-frequent gene_group_data 7 (# (# SmD1 10) (# SmF 13) (# SmE 13) (# SNRPG 13) (# SmD3 13) (# SmB 13)))
(less-frequent gene_group_data 7 (# (# Lsp2 1) (# Rab9Fa 1) (# Rab8 1) (# Rab23 1) (# Rab3 1) (# Rab14 1) (# Rab7 1)))













;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_map_table_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_map_table_fb_2023_04.tsv
!(file-name gene_map_table  data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_map_table_fb_2023_04.tsv)
(num-columns gene_map_table 6)
(duplicated-rows gene_map_table 0)
(total-rows gene_map_table 245829)
(unique-values gene_map_table 1 542 object)
(unique-values gene_map_table 2 245829 object)
(unique-values gene_map_table 3 245829 object)
(unique-values gene_map_table 4 1716 object)
(unique-values gene_map_table 5 8138 object)
(unique-values gene_map_table 6 17721 object)
(missing-values gene_map_table 1 0 () ())
(missing-values gene_map_table 2 0 () ())
(missing-values gene_map_table 3 0 () ())
(null-value-count gene_map_table 4 "" 208914)
(missing-values gene_map_table 4 208914 (# "") (# 208914))
(null-value-count gene_map_table 5 "" 222613)
(null-value-count gene_map_table 5 "-" 105)
(missing-values gene_map_table 5 222718 (# "" "-") (# 222613 105))
(null-value-count gene_map_table 6 "" 227926)
(missing-values gene_map_table 6 227926 (# "") (# 227926))
(most-frequent gene_map_table 1 (# (# Dper 18137) (# Dana 18521) (# Dwil 18542) (# Dyak 19506) (# Dsim 20501) (# Dpse 22460) (# Dmel 31755)))
(less-frequent gene_map_table 1 (# (# Dmos 1) (# Dsch 1) (# Dprg 1) (# Dpme 1) (# Dmds 1) (# Dbis 1) (# Dsut 1)))
(most-frequent gene_map_table 4 (# (# "1-" 1161) (# "XL-" 1883) (# "4-" 2182) (# "XR-" 2261) (# "3-" 3567) (# "2-" 4139)))
(less-frequent gene_map_table 4 (# (# "2-[90]" 1) (# "3-50-62" 1) (# "1-38.4" 1) (# "3-[76]" 1) (# "3-[25]" 1) (# "1-[61]" 1) (# "2-[24]" 1)))
(most-frequent gene_map_table 5 (# (# "61-100" 47) (# "39D5-39D5" 47) (# "21E2-21E2" 73) (# "56E2-56E2" 123) (# "21-60" 132)))
(less-frequent gene_map_table 5 (# (# "92A2-92A3" 1) (# "18E5-18F1" 1) (# "78A2-78B1" 1) (# "95C5-95C8" 1) (# "18B8-18B8" 1) (# "61F2-61F3" 1) (# "53A2-53A3" 1)))
(most-frequent gene_map_table 6 (# (# "2R:10351533..10352161(-1)" 3) (# "2R:13209809..13212237(-1)" 3) (# "3R:21365609..21368279(1)" 3) (# "2R:21667541..21669916(-1)" 4) (# "3R:13813109..13814648(1)" 4) (# "3R:21355692..21359768(-1)" 5)))
(less-frequent gene_map_table 6 (# (# "3R:19373757..19374789(-1)" 1) (# "3L:11574764..11577044(-1)" 1) (# "3L:11572797..11574663(-1)" 1) (# "X:20178755..20179729(-1)" 1) (# "3L:10692530..10693167(-1)" 1) (# "3R:25493481..25495161(-1)" 1) (# "X:20186630..20187604(-1)" 1)))


;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_rpkm_matrix_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_rpkm_matrix_fb_2023_04.tsv
;; /opt/logicmoo_workspace/packs_sys/logicmoo_opencog/MeTTa/vspace-metta/metta_vspace/metta_learner.py:3098: DtypeWarning: Columns (46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68,69,70,71,72,73,74,75,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90,91,92,93,94,95,102,103,104,105,106,107,108,109,110,111,112,113,114,115,116,117,118,119,120,121,122,123,124,125,126,127) have mixed types. Specify dtype option on import or set low_memory=False.
;;   return pd.read_csv(file_path, sep=sep, encoding=enc, comment='#',
!(file-name gene_rpkm_matrix  data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_rpkm_matrix_fb_2023_04.tsv)
(num-columns gene_rpkm_matrix 170)
(duplicated-rows gene_rpkm_matrix 0)
(total-rows gene_rpkm_matrix 17747)
(unique-values gene_rpkm_matrix 1 17747 object)
(unique-values gene_rpkm_matrix 2 17747 object)
(unique-values gene_rpkm_matrix 3 11214 object)
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_rpkm_report_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_rpkm_report_fb_2023_04.tsv
;; /opt/logicmoo_workspace/packs_sys/logicmoo_opencog/MeTTa/vspace-metta/metta_vspace/metta_learner.py:3098: DtypeWarning: Columns (9) have mixed types. Specify dtype option on import or set low_memory=False.
;;   return pd.read_csv(file_path, sep=sep, encoding=enc, comment='#',
!(file-name gene_rpkm_report  data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_rpkm_report_fb_2023_04.tsv)
(num-columns gene_rpkm_report 12)
(duplicated-rows gene_rpkm_report 0)
(total-rows gene_rpkm_report 2928711)
(unique-values gene_rpkm_report 1 1 object)
(unique-values gene_rpkm_report 2 17748 object)
(unique-values gene_rpkm_report 3 17748 object)
(unique-values gene_rpkm_report 4 7 object)
(unique-values gene_rpkm_report 5 7 object)
(unique-values gene_rpkm_report 6 166 object)
(unique-values gene_rpkm_report 7 166 object)
(unique-values gene_rpkm_report 8 5113 int64)
(unique-values gene_rpkm_report 9 8 int64)
(unique-values gene_rpkm_report 10 6776 object)
(unique-values gene_rpkm_report 11 5412 int64)
(unique-values gene_rpkm_report 12 2 object)
(missing-values gene_rpkm_report 1 0 () ())
(missing-values gene_rpkm_report 2 0 () ())
(missing-values gene_rpkm_report 3 0 () ())
(missing-values gene_rpkm_report 4 0 () ())
(missing-values gene_rpkm_report 5 0 () ())
(missing-values gene_rpkm_report 6 0 () ())
(missing-values gene_rpkm_report 7 0 () ())
(missing-values gene_rpkm_report 8 0 () ())
(missing-values gene_rpkm_report 9 0 () ())
(null-value-count gene_rpkm_report 10 "" 60536)
(missing-values gene_rpkm_report 10 60536 (# "") (# 60536))
(missing-values gene_rpkm_report 11 0 () ())
(missing-values gene_rpkm_report 12 0 () ())
(most-frequent gene_rpkm_report 1 (# (# "Dmel_R6.53" 2928711)))
(less-frequent gene_rpkm_report 1 (# (# "Dmel_R6.53" 2928711)))
(most-frequent gene_rpkm_report 2 (# (# FBgn0053410 166) (# FBgn0053411 166) (# FBgn0053412 166) (# FBgn0053413 166) (# FBgn0053414 166) (# FBgn0053408 166) (# FBgn0038694 166)))
(less-frequent gene_rpkm_report 2 (# (# FBgn0267595 40) (# FBgn0013691 42) (# FBgn0013673 42) (# FBgn0013701 42) (# FBgn0013700 42) (# FBgn0013674 42) (# FBgn0013675 42)))
(most-frequent gene_rpkm_report 3 (# (# "5SrRNA:CR33410" 166) (# "5SrRNA:CR33411" 166) (# "5SrRNA:CR33412" 166) (# "5SrRNA:CR33413" 166) (# "5SrRNA:CR33414" 166) (# "5SrRNA:CR33408" 166) (# CG5217 166)))
(less-frequent gene_rpkm_report 3 (# (# CR45933 40) (# "mt:tRNA:Asp-GTC" 42) (# "mt:ATPase8" 42) (# "mt:tRNA:Asn-GTT" 42) (# "mt:tRNA:Met-CAT" 42) (# "mt:CoI" 42) (# "mt:CoII" 42)))
(most-frequent gene_rpkm_report 4 (# (# FBlc0003342 35368) (# FBlc0000060 211421) (# FBlc0000260 424996) (# FBlc0000236 477917) (# FBlc0000206 513566) (# FBlc0000085 528553) (# FBlc0003498 736890)))
(less-frequent gene_rpkm_report 4 (# (# FBlc0003342 35368) (# FBlc0000060 211421) (# FBlc0000260 424996) (# FBlc0000236 477917) (# FBlc0000206 513566) (# FBlc0000085 528553) (# FBlc0003498 736890)))
(most-frequent gene_rpkm_report 5 (# (# "Knoblich_Neural_Cell_RNA-Seq" 35368) (# "BCM_1_RNAseq" 211421) (# "modENCODE_mRNA-Seq_cell.B" 424996) (# "modENCODE_mRNA-Seq_treatments" 477917) (# "modENCODE_mRNA-Seq_tissues" 513566) (# "modENCODE_mRNA-Seq_development" 528553) (# FlyAtlas2 736890)))
(less-frequent gene_rpkm_report 5 (# (# "Knoblich_Neural_Cell_RNA-Seq" 35368) (# "BCM_1_RNAseq" 211421) (# "modENCODE_mRNA-Seq_cell.B" 424996) (# "modENCODE_mRNA-Seq_treatments" 477917) (# "modENCODE_mRNA-Seq_tissues" 513566) (# "modENCODE_mRNA-Seq_development" 528553) (# FlyAtlas2 736890)))
(most-frequent gene_rpkm_report 6 (# (# FBlc0000235 17711) (# FBlc0000234 17711) (# FBlc0000233 17711) (# FBlc0000229 17711) (# FBlc0000217 17711) (# FBlc0000251 17711) (# FBlc0000250 17711)))
(less-frequent gene_rpkm_report 6 (# (# FBlc0003639 17545) (# FBlc0003637 17545) (# FBlc0003636 17545) (# FBlc0003635 17545) (# FBlc0003634 17545) (# FBlc0003633 17545) (# FBlc0003632 17545)))
(most-frequent gene_rpkm_report 7 (# (# "mE_mRNA_P8_fat" 17711) (# "mE_mRNA_WPP_saliv" 17711) (# "mE_mRNA_WPP_fat" 17711) (# "mE_mRNA_L3_Wand_imag_disc" 17711) (# "mE_mRNA_A_MateM_4d_testis" 17711) (# "mE_mRNA_A_4d_Paraquat_10mM" 17711) (# "mE_mRNA_A_4d_Paraquat_5mM" 17711)))
(less-frequent gene_rpkm_report 7 (# (# "RNA-Seq_Profile_FlyAtlas2_Adult_Male_FatBody" 17545) (# "RNA-Seq_Profile_FlyAtlas2_Adult_Male_Carcass" 17545) (# "RNA-Seq_Profile_FlyAtlas2_Adult_Male_Crop" 17545) (# "RNA-Seq_Profile_FlyAtlas2_Adult_Male_Brain" 17545) (# "RNA-Seq_Profile_FlyAtlas2_Adult_Female_Whole" 17545) (# "RNA-Seq_Profile_FlyAtlas2_Adult_Female_Virgin_Spermathecum" 17545) (# "RNA-Seq_Profile_FlyAtlas2_Adult_Female_Mated_Spermathecum" 17545)))
(most-frequent gene_rpkm_report 8 (# (# 6 67267) (# 5 76452) (# 4 89006) (# 3 106255) (# 2 139559) (# 1 256023) (# 0 1229976)))
(less-frequent gene_rpkm_report 8 (# (# 4755 1) (# 3974 1) (# 2566 1) (# 3991 1) (# 10214 1) (# 15694 1) (# 3308 1)))
(most-frequent gene_rpkm_report 9 (# (# 6 94410) (# 5 101416) (# 4 187170) (# 3 362858) (# 2 439025) (# 1 501837) (# 0 1229976)))
(less-frequent gene_rpkm_report 9 (# (# 7 12019) (# 6 94410) (# 5 101416) (# 4 187170) (# 3 362858) (# 2 439025) (# 1 501837)))
(most-frequent gene_rpkm_report 10 (# (# 45.0 5314) (# 72 7512) (# 44.0 8878) (# 72.0 11038) (# 73 11536) (# 135.0 17264)))
(less-frequent gene_rpkm_report 10 (# (# 2235 15) (# 939 42) (# 667 42) (# 155 42) (# 1536 42) (# 354 42) (# 290 42)))
(most-frequent gene_rpkm_report 11 (# (# 595 4980) (# 74 5098) (# 45 5872) (# 44 9390) (# 135 17014) (# 73 17014) (# 72 18668)))
(less-frequent gene_rpkm_report 11 (# (# 62 42) (# 63 42) (# 16924 82) (# 230 82) (# 3528 82) (# 193 82) (# 16779 84)))
(most-frequent gene_rpkm_report 12 (# (# Total 73206) (# Unique 2855505)))
(less-frequent gene_rpkm_report 12 (# (# Total 73206) (# Unique 2855505)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_snapshots_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_snapshots_fb_2023_04.tsv
!(file-name gene_snapshots  data/ftp.flybase.net/releases/current/precomputed_files/genes/gene_snapshots_fb_2023_04.tsv)
(num-columns gene_snapshots 5)
(duplicated-rows gene_snapshots 0)
(total-rows gene_snapshots 13985)
(unique-values gene_snapshots 1 13985 object)
(unique-values gene_snapshots 2 13985 object)
(unique-values gene_snapshots 3 7833 object)
(unique-values gene_snapshots 4 61 object)
(unique-values gene_snapshots 5 3652 object)
(missing-values gene_snapshots 1 0 () ())
(missing-values gene_snapshots 2 0 () ())
(null-value-count gene_snapshots 3 "-" 6153)
(missing-values gene_snapshots 3 6153 (# "-") (# 6153))
(null-value-count gene_snapshots 4 "-" 10334)
(missing-values gene_snapshots 4 10334 (# "-") (# 10334))
(missing-values gene_snapshots 5 0 () ())
(most-frequent gene_snapshots 3 (# (# "Carbonic anhydrase 2" 1) (# "PRL-1 phosphatase" 1) (# tricornered 1) (# kurz 1) (# "beaten path IV" 1) (# "male sterile (2) 35Ci" 1)))
(less-frequent gene_snapshots 3 (# (# "Receptor expression enhancing protein A" 1) (# tricornered 1) (# "PRL-1 phosphatase" 1) (# "Carbonic anhydrase 2" 1) (# "sugar transporter 3" 1) (# spt4 1) (# "Imitation SWI" 1)))
(most-frequent gene_snapshots 4 (# (# 20190919.0 144) (# 20190926.0 198) (# 20190912.0 206) (# 20190321.0 222) (# 20190307.0 862) (# 20190314.0 1067)))
(less-frequent gene_snapshots 4 (# (# 20220901.0 1) (# 20200924.0 1) (# 20200730.0 1) (# 20200709.0 1) (# 20190725.0 1) (# 20210204.0 1) (# 20160630.0 1)))
(most-frequent gene_snapshots 5 (# (# "stumps (stumps) encodes a fibroblast growth factor (FGF) scaffolding protein. Upon FGF receptor activation, it mediates the recruitment of the phosphatase encoded by csw, which is essential for the activation of the MAPK pathway." 1) (# "lectin-24Db (lectin-24Db) encodes a protein that interacts specifically with fucose and mannose." 1) (# "Apoptosis inducing factor (AIF) encodes a phylogenetically conserved redox-active flavoprotein that contributes to cell death and oxidative phosphorylation in mitochondria." 1) (# "Lsm10 (Lsm10) encodes a core component of the U7 snRNP complex, which functions in 3' end processing of the non-polyadenylated, replication-dependent histone mRNAs. The product of Lsm10 is part of the heptameric Sm ring complex that binds directly to U7 snRNA. It replaces the protein encoded by SmD1 in the canonical heptameric Sm protein ring that binds spliceosomal snRNAs." 1) (# "prenyl protease type I (ste24a) encodes a protein that, along with the products of ste24b and ste24c, are paralogous (tandemly duplicated) type I prenyl proteases." 1) (# "dachshund (dac) encodes a transcriptional cofactor that physically interacts with several other retinal determination proteins, including those encoded by eya and so, and regulates eye, leg, gonad, and brain development." 1) (# "Contributions welcome." 10334)))
(less-frequent gene_snapshots 5 (# (# "Down syndrome cell adhesion molecule 2 (Dscam2) encodes a transmembrane protein. Its alternative splicing produces two biochemically distinct homophilic binding proteins expressed in different cells. It can mediate both repulsion and adhesion between neurons and contributes to boundary formation, neurite targeting and synapse formation in the brain." 1) (# "prenyl protease type I (ste24a) encodes a protein that, along with the products of ste24b and ste24c, are paralogous (tandemly duplicated) type I prenyl proteases." 1) (# "Lsm10 (Lsm10) encodes a core component of the U7 snRNP complex, which functions in 3' end processing of the non-polyadenylated, replication-dependent histone mRNAs. The product of Lsm10 is part of the heptameric Sm ring complex that binds directly to U7 snRNA. It replaces the protein encoded by SmD1 in the canonical heptameric Sm protein ring that binds spliceosomal snRNAs." 1) (# "Apoptosis inducing factor (AIF) encodes a phylogenetically conserved redox-active flavoprotein that contributes to cell death and oxidative phosphorylation in mitochondria." 1) (# "lectin-24Db (lectin-24Db) encodes a protein that interacts specifically with fucose and mannose." 1) (# "stumps (stumps) encodes a fibroblast growth factor (FGF) scaffolding protein. Upon FGF receptor activation, it mediates the recruitment of the phosphatase encoded by csw, which is essential for the activation of the MAPK pathway." 1) (# "expanded (ex) encodes a FERM-domain containing protein that localizes to apical cell-cell junctions, where it promotes Hippo signaling by physically interacting with multiple Hippo pathway components. Through its regulation of Hippo signaling, the product of ex functions as an inhibitor of growth." 1)))
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/ncRNA_genes_fb_2023_04.json
!(file-name ncRNA_genes_  data/ftp.flybase.net/releases/current/precomputed_files/genes/ncRNA_genes_fb_2023_04.json)
(num-columns ncRNA_genes_ 2)
(duplicated-rows ncRNA_genes_ 145327)
(total-rows ncRNA_genes_ 212303)
(unique-values ncRNA_genes_ 1 66975 object)
(unique-values ncRNA_genes_ 2 3 object)
(missing-values ncRNA_genes_ 1 0 () ())
(null-value-count ncRNA_genes_ 2 "" 21161)
(missing-values ncRNA_genes_ 2 21161 (# "") (# 21161))
(most-frequent ncRNA_genes_ 1 (# (# "                         \"gca_accession\": \"GCA_000001215.4\", " 4566) (# "                         \"exons\": [" 4566) (# "          " 4566) (# "                    }" 5311) (# "                    " 5534) (# "                              " 6494) (# "               ], " 13710)))
(less-frequent ncRNA_genes_ 1 (# (# "     \"metaData\": " 1) (# "                                   \"endPosition\": 23114377" 1) (# "                                   \"startPosition\": 23113577, " 1) (# "                                   \"endPosition\": 23114049" 1) (# "                    \"geneId\": \"FLYBASE:FBgn0266009\", " 1) (# "                    \"symbol\": \"lncRNA:CR44782\", " 1) (# "                    \"url\": \"http://flybase.org/reports/FBgn0266009.html\", " 1)))
(most-frequent ncRNA_genes_ 2 (# (# "}RR42320\"" 1) (# "}RR42263\"" 1)))
(less-frequent ncRNA_genes_ 2 (# (# "}RR42263\"" 1) (# "}RR42320\"" 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/pathway_group_data_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/pathway_group_data_fb_2023_04.tsv
!(file-name pathway_group_data  data/ftp.flybase.net/releases/current/precomputed_files/genes/pathway_group_data_fb_2023_04.tsv)
(num-columns pathway_group_data 7)
(duplicated-rows pathway_group_data 0)
(total-rows pathway_group_data 992)
(unique-values pathway_group_data 1 71 object)
(unique-values pathway_group_data 2 71 object)
(unique-values pathway_group_data 3 71 object)
(unique-values pathway_group_data 4 18 object)
(unique-values pathway_group_data 5 18 object)
(unique-values pathway_group_data 6 658 object)
(unique-values pathway_group_data 7 658 object)
(missing-values pathway_group_data 1 0 () ())
(missing-values pathway_group_data 2 0 () ())
(missing-values pathway_group_data 3 0 () ())
(null-value-count pathway_group_data 4 "" 17)
(missing-values pathway_group_data 4 17 (# "") (# 17))
(null-value-count pathway_group_data 5 "" 17)
(missing-values pathway_group_data 5 17 (# "") (# 17))
(null-value-count pathway_group_data 6 "" 17)
(missing-values pathway_group_data 6 17 (# "") (# 17))
(null-value-count pathway_group_data 7 "" 17)
(missing-values pathway_group_data 7 17 (# "") (# 17))
(most-frequent pathway_group_data 1 (# (# FBgg0001196 38) (# FBgg0001069 42) (# FBgg0000891 42) (# FBgg0000981 43) (# FBgg0000916 44) (# FBgg0000892 45) (# FBgg0000980 56)))
(less-frequent pathway_group_data 1 (# (# FBgg0000941 1) (# FBgg0001093 1) (# FBgg0000917 1) (# FBgg0000910 1) (# FBgg0000975 1) (# FBgg0000958 1) (# FBgg0000889 1)))
(most-frequent pathway_group_data 2 (# (# "IMD-N" 38) (# "NTCH-P" 42) (# "WNT-TCFN" 42) (# "HH-SMOP" 43) (# "SWH-N" 44) (# "WNT-TCFP" 45) (# "HH-SMON" 56)))
(less-frequent pathway_group_data 2 (# (# SEVL 1) (# "ACT-SMAD2" 1) (# SWH 1) (# INS 1) (# "PVR-P" 1) (# "EGFR-RTK" 1) (# "WNT-TCF" 1)))
(most-frequent pathway_group_data 3 (# (# "Negative Regulators of Imd Signaling Pathway" 38) (# "Positive Regulators of Notch Signaling Pathway" 42) (# "Negative Regulators of Wnt-TCF Signaling Pathway" 42) (# "Positive Regulators of Hedgehog Signaling Pathway" 43) (# "Negative Regulators of Hippo Signaling Pathway" 44) (# "Positive Regulators of Wnt-TCF Signaling Pathway" 45) (# "Negative Regulators of Hedgehog Signaling Pathway" 56)))
(less-frequent pathway_group_data 3 (# (# "Sevenless Signaling Pathway" 1) (# "Activin Signaling Pathway" 1) (# "Hippo Signaling Pathway" 1) (# "Insulin-like Receptor Signaling Pathway" 1) (# "Positive Regulators of Pvr Signaling Pathway" 1) (# "EGFR Signaling Pathway" 1) (# "Wnt-TCF Signaling Pathway" 1)))
(most-frequent pathway_group_data 4 (# (# FBgg0000910 77) (# FBgg0001059 79) (# FBgg0000958 83) (# FBgg0000917 87) (# FBgg0001068 89) (# FBgg0000889 100) (# FBgg0000978 108)))
(less-frequent pathway_group_data 4 (# (# FBgg0001792 6) (# FBgg0001093 14) (# FBgg0001560 23) (# FBgg0000941 30) (# FBgg0000934 31) (# FBgg0000967 35)))
(most-frequent pathway_group_data 5 (# (# INS 77) (# "TL-CAN" 79) (# "EGFR-RTK" 83) (# SWH 87) (# NTCH 89) (# "WNT-TCF" 100) (# "HH-SMO" 108)))
(less-frequent pathway_group_data 5 (# (# "CGAS-STING" 6) (# "ACT-SMAD2" 14) (# TNF 23) (# SEVL 30) (# TORS 31) (# FGFR 35)))
(most-frequent pathway_group_data 6 (# (# FBgn0010269 6) (# FBgn0004177 6) (# FBgn0262432 6) (# FBgn0283468 6) (# FBgn0003256 6) (# FBgn0004638 6)))
(less-frequent pathway_group_data 6 (# (# FBgn0262408 1) (# FBgn0027539 1) (# FBgn0001987 1) (# FBgn0005632 1) (# FBgn0043364 1) (# FBgn0000395 1) (# FBgn0261952 1)))
(most-frequent pathway_group_data 7 (# (# Dsor1 6) (# mts 6) (# "mir-8" 6) (# slmb 6) (# rl 6) (# drk 6)))
(less-frequent pathway_group_data 7 (# (# "mir-5" 1) (# lili 1) (# Gli 1) (# faf 1) (# cbt 1) (# "cv-2" 1) (# srw 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/genes/physical_interactions_mitab_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/physical_interactions_mitab_fb_2023_04.tsv
;; /opt/logicmoo_workspace/packs_sys/logicmoo_opencog/MeTTa/vspace-metta/metta_vspace/metta_learner.py:3098: DtypeWarning: Columns (35) have mixed types. Specify dtype option on import or set low_memory=False.
;;   return pd.read_csv(file_path, sep=sep, encoding=enc, comment='#',
!(file-name physical_interactions_mitab  data/ftp.flybase.net/releases/current/precomputed_files/genes/physical_interactions_mitab_fb_2023_04.tsv)
(num-columns physical_interactions_mitab 42)
(duplicated-rows physical_interactions_mitab 0)
(total-rows physical_interactions_mitab 51247)
(unique-values physical_interactions_mitab 1 4623 object)
(unique-values physical_interactions_mitab 2 5257 object)
(unique-values physical_interactions_mitab 3 4611 object)
(unique-values physical_interactions_mitab 4 5242 object)
(unique-values physical_interactions_mitab 5 4623 object)
(unique-values physical_interactions_mitab 6 5257 object)
(unique-values physical_interactions_mitab 7 111 object)
(unique-values physical_interactions_mitab 8 4823 object)
(unique-values physical_interactions_mitab 9 4941 object)
(unique-values physical_interactions_mitab 10 5 object)
(unique-values physical_interactions_mitab 11 4 object)
(unique-values physical_interactions_mitab 12 3 object)
(unique-values physical_interactions_mitab 13 1 object)
(unique-values physical_interactions_mitab 14 51247 object)
(unique-values physical_interactions_mitab 15 1 object)
(unique-values physical_interactions_mitab 16 1 object)
(unique-values physical_interactions_mitab 17 7 object)
(unique-values physical_interactions_mitab 18 8 object)
(unique-values physical_interactions_mitab 19 9 object)
(unique-values physical_interactions_mitab 20 9 object)
(unique-values physical_interactions_mitab 21 2 object)
(unique-values physical_interactions_mitab 22 2 object)
(unique-values physical_interactions_mitab 23 1 object)
(unique-values physical_interactions_mitab 24 1 object)
(unique-values physical_interactions_mitab 25 34325 object)
(unique-values physical_interactions_mitab 26 1037 object)
(unique-values physical_interactions_mitab 27 1040 object)
(unique-values physical_interactions_mitab 28 19939 object)
(unique-values physical_interactions_mitab 29 2 object)
(unique-values physical_interactions_mitab 30 2 object)
(unique-values physical_interactions_mitab 31 2 object)
(unique-values physical_interactions_mitab 32 2 object)
(unique-values physical_interactions_mitab 33 2 object)
(unique-values physical_interactions_mitab 34 2 object)
(unique-values physical_interactions_mitab 35 2 object)
(unique-values physical_interactions_mitab 36 3 object)
(unique-values physical_interactions_mitab 37 2 object)
(unique-values physical_interactions_mitab 38 2 object)
(unique-values physical_interactions_mitab 39 2 object)
(unique-values physical_interactions_mitab 40 2 object)
(unique-values physical_interactions_mitab 41 2 object)
(unique-values physical_interactions_mitab 42 2 object)
(missing-values physical_interactions_mitab 1 0 () ())
(missing-values physical_interactions_mitab 2 0 () ())
(null-value-count physical_interactions_mitab 3 "-" 23)
(missing-values physical_interactions_mitab 3 23 (# "-") (# 23))
(null-value-count physical_interactions_mitab 4 "-" 59)
(missing-values physical_interactions_mitab 4 59 (# "-") (# 59))
(missing-values physical_interactions_mitab 5 0 () ())
(missing-values physical_interactions_mitab 6 0 () ())
(null-value-count physical_interactions_mitab 7 "-" 231)
(missing-values physical_interactions_mitab 7 231 (# "-") (# 231))
(missing-values physical_interactions_mitab 8 0 () ())
(missing-values physical_interactions_mitab 9 0 () ())
(missing-values physical_interactions_mitab 10 0 () ())
(missing-values physical_interactions_mitab 11 0 () ())
(missing-values physical_interactions_mitab 12 0 () ())
(missing-values physical_interactions_mitab 13 0 () ())
(missing-values physical_interactions_mitab 14 0 () ())
(null-value-count physical_interactions_mitab 15 "-" 51247)
(missing-values physical_interactions_mitab 15 51247 (# "-") (# 51247))
(null-value-count physical_interactions_mitab 16 "-" 51247)
(missing-values physical_interactions_mitab 16 51247 (# "-") (# 51247))
(null-value-count physical_interactions_mitab 17 "-" 50635)
(missing-values physical_interactions_mitab 17 50635 (# "-") (# 50635))
(null-value-count physical_interactions_mitab 18 "-" 50634)
(missing-values physical_interactions_mitab 18 50634 (# "-") (# 50634))
(missing-values physical_interactions_mitab 19 0 () ())
(missing-values physical_interactions_mitab 20 0 () ())
(missing-values physical_interactions_mitab 21 0 () ())
(missing-values physical_interactions_mitab 22 0 () ())
(null-value-count physical_interactions_mitab 23 "-" 51247)
(missing-values physical_interactions_mitab 23 51247 (# "-") (# 51247))
(null-value-count physical_interactions_mitab 24 "-" 51247)
(missing-values physical_interactions_mitab 24 51247 (# "-") (# 51247))
(missing-values physical_interactions_mitab 25 0 () ())
(null-value-count physical_interactions_mitab 26 "-" 27320)
(missing-values physical_interactions_mitab 26 27320 (# "-") (# 27320))
(null-value-count physical_interactions_mitab 27 "-" 27569)
(missing-values physical_interactions_mitab 27 27569 (# "-") (# 27569))
(null-value-count physical_interactions_mitab 28 "-" 180)
(missing-values physical_interactions_mitab 28 180 (# "-") (# 180))
(null-value-count physical_interactions_mitab 29 "" 1)
(null-value-count physical_interactions_mitab 29 "-" 51246)
(missing-values physical_interactions_mitab 29 51247 (# "" "-") (# 1 51246))
(null-value-count physical_interactions_mitab 30 "" 1)
(null-value-count physical_interactions_mitab 30 "-" 51246)
(missing-values physical_interactions_mitab 30 51247 (# "" "-") (# 1 51246))
(null-value-count physical_interactions_mitab 31 "" 1)
(null-value-count physical_interactions_mitab 31 "-" 51246)
(missing-values physical_interactions_mitab 31 51247 (# "" "-") (# 1 51246))
(null-value-count physical_interactions_mitab 32 "" 1)
(null-value-count physical_interactions_mitab 32 "-" 51246)
(missing-values physical_interactions_mitab 32 51247 (# "" "-") (# 1 51246))
(null-value-count physical_interactions_mitab 33 "" 1)
(null-value-count physical_interactions_mitab 33 "-" 51246)
(missing-values physical_interactions_mitab 33 51247 (# "" "-") (# 1 51246))
(null-value-count physical_interactions_mitab 34 "" 1)
(null-value-count physical_interactions_mitab 34 "-" 51246)
(missing-values physical_interactions_mitab 34 51247 (# "" "-") (# 1 51246))
(null-value-count physical_interactions_mitab 35 "" 1)
(null-value-count physical_interactions_mitab 35 "-" 51246)
(missing-values physical_interactions_mitab 35 51247 (# "" "-") (# 1 51246))
(null-value-count physical_interactions_mitab 36 "" 1)
(missing-values physical_interactions_mitab 36 1 (# "") (# 1))
(null-value-count physical_interactions_mitab 37 "" 1)
(null-value-count physical_interactions_mitab 37 "-" 51246)
(missing-values physical_interactions_mitab 37 51247 (# "" "-") (# 1 51246))
(null-value-count physical_interactions_mitab 38 "" 1)
(null-value-count physical_interactions_mitab 38 "-" 51246)
(missing-values physical_interactions_mitab 38 51247 (# "" "-") (# 1 51246))
(null-value-count physical_interactions_mitab 39 "" 1)
(null-value-count physical_interactions_mitab 39 "-" 51246)
(missing-values physical_interactions_mitab 39 51247 (# "" "-") (# 1 51246))
(null-value-count physical_interactions_mitab 40 "" 1)
(null-value-count physical_interactions_mitab 40 "-" 51246)
(missing-values physical_interactions_mitab 40 51247 (# "" "-") (# 1 51246))
(null-value-count physical_interactions_mitab 41 "" 1)
(null-value-count physical_interactions_mitab 41 "-" 51246)
(missing-values physical_interactions_mitab 41 51247 (# "" "-") (# 1 51246))
(null-value-count physical_interactions_mitab 42 "" 1)
(null-value-count physical_interactions_mitab 42 "-" 51246)
(missing-values physical_interactions_mitab 42 51247 (# "" "-") (# 1 51246))
(most-frequent physical_interactions_mitab 1 (# (# FBgn0001199 188) (# FBgn0000212 204) (# FBgn0015239 209) (# FBgn0003944 220) (# FBgn0000014 237) (# FBgn0000283 259) (# FBgn0003607 275)))
(less-frequent physical_interactions_mitab 1 (# (# FBgn0028412 1) (# FBgn0003312 1) (# FBgn0015773 1) (# FBgn0032644 1) (# FBgn0033685 1) (# FBgn0028847 1) (# FBgn0038880 1)))
(most-frequent physical_interactions_mitab 2 (# (# FBgn0264922 155) (# FBgn0034970 159) (# FBgn0037555 168) (# FBgn0263979 175) (# FBgn0262866 178) (# FBgn0262739 185) (# FBgn0266411 188)))
(less-frequent physical_interactions_mitab 2 (# (# FBgn0036437 1) (# FBgn0066365 1) (# FBgn0040773 1) (# FBgn0019929 1) (# FBgn0033192 1) (# FBgn0000147 1) (# FBgn0052450 1)))
(most-frequent physical_interactions_mitab 3 (# (# "entrez gene/locuslink:318847" 188) (# "CG5942|entrez gene/locuslink:39744" 204) (# "CG7199|entrez gene/locuslink:40378" 209) (# "CG10388|entrez gene/locuslink:42034" 220) (# "CG10325|entrez gene/locuslink:42037" 237) (# "CG6384|entrez gene/locuslink:41848" 259) (# "CG8409|entrez gene/locuslink:34119" 275)))
(less-frequent physical_interactions_mitab 3 (# (# "CG6541|entrez gene/locuslink:34578" 1) (# "CG8611|entrez gene/locuslink:32725" 1) (# "CG11490|entrez gene/locuslink:33184" 1) (# "CG42341|entrez gene/locuslink:40305" 1) (# "CG32213|entrez gene/locuslink:317918" 1) (# "CG1976|entrez gene/locuslink:43758" 1) (# "CG2943|entrez gene/locuslink:40933" 1)))
(most-frequent physical_interactions_mitab 4 (# (# "CG4494|entrez gene/locuslink:33981" 155) (# "CG4005|entrez gene/locuslink:37851" 159) (# "CG9638|entrez gene/locuslink:40966" 168) (# "CG4236|entrez gene/locuslink:41836" 175) (# "CG17596|entrez gene/locuslink:33139" 178) (# "CG6671|entrez gene/locuslink:36544" 185) (# "CG45051|entrez gene/locuslink:43580" 188)))
(less-frequent physical_interactions_mitab 4 (# (# "CG5048|entrez gene/locuslink:39598" 1) (# "CG4705|entrez gene/locuslink:34540" 1) (# "CG11659|entrez gene/locuslink:42352" 1) (# "CR43012|entrez gene/locuslink:12798490" 1) (# "CG44086|entrez gene/locuslink:34032" 1) (# "entrez gene/locuslink:3772715" 1) (# "CG12090|entrez gene/locuslink:38176" 1)))
(most-frequent physical_interactions_mitab 5 (# (# "His3(gene name)" 188) (# "brm(gene name)" 204) (# "Hr78(gene name)" 209) (# "Ubx(gene name)" 220) (# "abd-A(gene name)" 237) (# "Cp190(gene name)" 259) (# "flybase:\"Su(var)205\"(gene name)" 275)))
(less-frequent physical_interactions_mitab 5 (# (# "Mst33A(gene name)" 1) (# "sad(gene name)" 1) (# "NetA(gene name)" 1) (# "CG5131(gene name)" 1) (# "OSCP1(gene name)" 1) (# "CG9014(gene name)" 1) (# "SIFaR(gene name)" 1)))
(most-frequent physical_interactions_mitab 6 (# (# "Sumo(gene name)" 155) (# "yki(gene name)" 159) (# "Ada2b(gene name)" 168) (# "Caf1-55(gene name)" 175) (# "S6kII(gene name)" 178) (# "AGO1(gene name)" 185) (# "sima(gene name)" 188)))
(less-frequent physical_interactions_mitab 6 (# (# "Dnaaf6(gene name)" 1) (# "dyl(gene name)" 1) (# "COX7C(gene name)" 1) (# "Ser7(gene name)" 1) (# "Corin(gene name)" 1) (# "aurA(gene name)" 1) (# "CG32450(gene name)" 1)))
(most-frequent physical_interactions_mitab 7 (# (# "psi-mi:\"MI:0397\"(two hybrid array)" 2067) (# "psi-mi:\"MI:0027\"(cosedimentation)" 4090) (# "psi-mi:\"MI:0096\"(pull down)" 4202) (# "psi-mi:\"MI:0006\"(anti bait coimmunoprecipitation)" 5251) (# "psi-mi:\"MI:0018\"(two hybrid)" 5958) (# "psi-mi:\"MI:0046\"(experimental knowledge based)" 10942) (# "psi-mi:\"MI:0007\"(anti tag coimmunoprecipitation)" 12395)))
(less-frequent physical_interactions_mitab 7 (# (# "psi-mi:\"MI:0042\"(electron paramagnetic resonance)" 1) (# "psi-mi:\"MI:0928\"(filter trap assay)" 1) (# "psi-mi:\"MI:1183\"(nuclease footprinting)" 1) (# "psi-mi:\"MI:1238\"(mass spectrometry studies of subunit exchange)" 1) (# "psi-mi:\"MI:0370\"(tox-r dimerization assay)" 1) (# "psi-mi:\"MI:0048\"(filamentous phage display)" 1) (# "psi-mi:\"MI:0605\"(enzymatic footprinting)" 1)))
(most-frequent physical_interactions_mitab 8 (# (# "Friedman A.A. (2011)" 400) (# "Rhee D.Y. (2014)" 618) (# "Vinayagam A. (2016)" 1808) (# "Shokri L. (2019)" 2109) (# "Hu Y. (2017.6.13)" 3634) (# "Anger A.M. (2013)" 3828) (# "Guruharsha K.G. (2011)" 10947)))
(less-frequent physical_interactions_mitab 8 (# (# "Geng J. (2023)" 1) (# "Mellone B.G. (2011)" 1) (# "Lim Y.M. (2013)" 1) (# "Tran T.A. (2013)" 1) (# "Ooe N. (2007)" 1) (# "Jiang L. (2007)" 1) (# "Nagai H. (2021)" 1)))
(most-frequent physical_interactions_mitab 9 (# (# "FBrf0224702|pubmed:22028469" 386) (# "FBrf0227292|pubmed:25242320" 618) (# "FBrf0233454|pubmed:27626673" 1808) (# "FBrf0241977|pubmed:30995488" 2109) (# FBrf0235788 3634) (# "FBrf0221476|pubmed:23636399" 3828) (# "FBrf0218395|pubmed:22036573" 10947)))
(less-frequent physical_interactions_mitab 9 (# (# "FBrf0057159|pubmed:1372522" 1) (# "FBrf0208241|pubmed:19348939" 1) (# "FBrf0204148|pubmed:17900877" 1) (# "FBrf0192396|pubmed:17224403" 1) (# "FBrf0192282|pubmed:17166919" 1) (# "FBrf0130030|pubmed:10801879" 1) (# "FBrf0134475|pubmed:11267682" 1)))
(most-frequent physical_interactions_mitab 10 (# (# "taxid:10116(\"Rattus norvegicus\")" 1) (# "taxid:46015(\"Nucleopolyhedrovirus Autographa californica nucleopolyhedrovirus\")" 1) (# "taxid:11676(\"Lentivirus Human immunodeficiency virus type 1\")" 2) (# "taxid:9606(\"Homo sapiens\")" 27) (# "taxid:7227(\"Drosophila melanogaster\")" 51216)))
(less-frequent physical_interactions_mitab 10 (# (# "taxid:46015(\"Nucleopolyhedrovirus Autographa californica nucleopolyhedrovirus\")" 1) (# "taxid:10116(\"Rattus norvegicus\")" 1) (# "taxid:11676(\"Lentivirus Human immunodeficiency virus type 1\")" 2) (# "taxid:9606(\"Homo sapiens\")" 27) (# "taxid:7227(\"Drosophila melanogaster\")" 51216)))
(most-frequent physical_interactions_mitab 11 (# (# "taxid:32644(\"unknown unknown\")" 1) (# "taxid:81077(\"artificial artificial\")" 3) (# "taxid:9606(\"Homo sapiens\")" 23) (# "taxid:7227(\"Drosophila melanogaster\")" 51220)))
(less-frequent physical_interactions_mitab 11 (# (# "taxid:32644(\"unknown unknown\")" 1) (# "taxid:81077(\"artificial artificial\")" 3) (# "taxid:9606(\"Homo sapiens\")" 23) (# "taxid:7227(\"Drosophila melanogaster\")" 51220)))
(most-frequent physical_interactions_mitab 12 (# (# "psi-mi:\"MI:1110\"(predicted interaction)" 3) (# "psi-mi:\"MI:0403\"(colocalization)" 10) (# "psi-mi:\"MI:0915\"(physical association)" 51234)))
(less-frequent physical_interactions_mitab 12 (# (# "psi-mi:\"MI:1110\"(predicted interaction)" 3) (# "psi-mi:\"MI:0403\"(colocalization)" 10) (# "psi-mi:\"MI:0915\"(physical association)" 51234)))
(most-frequent physical_interactions_mitab 13 (# (# "psi-mi:\"MI:0478\"(flybase)" 51247)))
(less-frequent physical_interactions_mitab 13 (# (# "psi-mi:\"MI:0478\"(flybase)" 51247)))
(most-frequent physical_interactions_mitab 15 ())
(less-frequent physical_interactions_mitab 15 ())
(most-frequent physical_interactions_mitab 16 ())
(less-frequent physical_interactions_mitab 16 ())
(most-frequent physical_interactions_mitab 17 (# (# "psi-mi:\"MI:0918\"(donor)" 2) (# "psi-mi:\"MI:0840\"(stimulator)" 3) (# "psi-mi:\"MI:1343\"(enzyme regulator)" 5) (# "psi-mi:\"MI:0586\"(inhibitor)" 5) (# "psi-mi:\"MI:0501\"(enzyme)" 284) (# "psi-mi:\"MI:0502\"(enzyme target)" 313)))
(less-frequent physical_interactions_mitab 17 (# (# "psi-mi:\"MI:0918\"(donor)" 2) (# "psi-mi:\"MI:0840\"(stimulator)" 3) (# "psi-mi:\"MI:0586\"(inhibitor)" 5) (# "psi-mi:\"MI:1343\"(enzyme regulator)" 5) (# "psi-mi:\"MI:0501\"(enzyme)" 284) (# "psi-mi:\"MI:0502\"(enzyme target)" 313)))
(most-frequent physical_interactions_mitab 18 (# (# "psi-mi:\"MI:0918\"(donor)" 1) (# "psi-mi:\"MI:0840\"(stimulator)" 5) (# "psi-mi:\"MI:0586\"(inhibitor)" 13) (# "psi-mi:\"MI:1343\"(enzyme regulator)" 13) (# "psi-mi:\"MI:0502\"(enzyme target)" 230) (# "psi-mi:\"MI:0501\"(enzyme)" 350)))
(less-frequent physical_interactions_mitab 18 (# (# "psi-mi:\"MI:0918\"(donor)" 1) (# "psi-mi:\"MI:0919\"(acceptor)" 1) (# "psi-mi:\"MI:0840\"(stimulator)" 5) (# "psi-mi:\"MI:1343\"(enzyme regulator)" 13) (# "psi-mi:\"MI:0586\"(inhibitor)" 13) (# "psi-mi:\"MI:0502\"(enzyme target)" 230) (# "psi-mi:\"MI:0501\"(enzyme)" 350)))
(most-frequent physical_interactions_mitab 19 (# (# "psi-mi:\"MI:0584\"(fluorescence acceptor)" 33) (# "psi-mi:\"MI:0583\"(fluorescence donor)" 83) (# "psi-mi:\"MI:0503\"(self)" 346) (# "psi-mi:\"MI:0497\"(neutral component)" 5702) (# "psi-mi:\"MI:0499\"(unspecified role)" 12291) (# "psi-mi:\"MI:0498\"(prey)" 15993) (# "psi-mi:\"MI:0496\"(bait)" 16786)))
(less-frequent physical_interactions_mitab 19 (# (# "psi-mi:\"MI:0898\"(putative self)" 2) (# "psi-mi:\"MI:0684\"(ancillary)" 11) (# "psi-mi:\"MI:0584\"(fluorescence acceptor)" 33) (# "psi-mi:\"MI:0583\"(fluorescence donor)" 83) (# "psi-mi:\"MI:0503\"(self)" 346) (# "psi-mi:\"MI:0497\"(neutral component)" 5702) (# "psi-mi:\"MI:0499\"(unspecified role)" 12291)))
(most-frequent physical_interactions_mitab 20 (# (# "psi-mi:\"MI:0584\"(fluorescence acceptor)" 50) (# "psi-mi:\"MI:0583\"(fluorescence donor)" 66) (# "psi-mi:\"MI:0503\"(self)" 345) (# "psi-mi:\"MI:0497\"(neutral component)" 5699) (# "psi-mi:\"MI:0499\"(unspecified role)" 12290) (# "psi-mi:\"MI:0498\"(prey)" 15747) (# "psi-mi:\"MI:0496\"(bait)" 17033)))
(less-frequent physical_interactions_mitab 20 (# (# "psi-mi:\"MI:0898\"(putative self)" 2) (# "psi-mi:\"MI:0684\"(ancillary)" 15) (# "psi-mi:\"MI:0584\"(fluorescence acceptor)" 50) (# "psi-mi:\"MI:0583\"(fluorescence donor)" 66) (# "psi-mi:\"MI:0503\"(self)" 345) (# "psi-mi:\"MI:0497\"(neutral component)" 5699) (# "psi-mi:\"MI:0499\"(unspecified role)" 12290)))
(most-frequent physical_interactions_mitab 21 (# (# "psi-mi:\"MI:0320\"(ribonucleic acid)" 1861) (# "psi-mi:\"MI:0326\"(protein)" 49386)))
(less-frequent physical_interactions_mitab 21 (# (# "psi-mi:\"MI:0320\"(ribonucleic acid)" 1861) (# "psi-mi:\"MI:0326\"(protein)" 49386)))
(most-frequent physical_interactions_mitab 22 (# (# "psi-mi:\"MI:0320\"(ribonucleic acid)" 2024) (# "psi-mi:\"MI:0326\"(protein)" 49223)))
(less-frequent physical_interactions_mitab 22 (# (# "psi-mi:\"MI:0320\"(ribonucleic acid)" 2024) (# "psi-mi:\"MI:0326\"(protein)" 49223)))
(most-frequent physical_interactions_mitab 23 ())
(less-frequent physical_interactions_mitab 23 ())
(most-frequent physical_interactions_mitab 24 ())
(less-frequent physical_interactions_mitab 24 ())
(most-frequent physical_interactions_mitab 25 (# (# FBig0000071265 36) (# FBig0000095560 38) (# FBig0000097702 38) (# FBig0000095735 38) (# FBig0000086228 40) (# FBig0000067005 44) (# FBig0000017021 46)))
(less-frequent physical_interactions_mitab 25 (# (# FBig0000000059 1) (# FBig0000108279 1) (# FBig0000108278 1) (# FBig0000108277 1) (# FBig0000108275 1) (# FBig0000108274 1) (# FBig0000108273 1)))
(most-frequent physical_interactions_mitab 26 (# (# "comment:\"HA tag\"" 1318) (# "comment:\"GFP tag\"" 1380) (# "comment:\"GST tag\"" 1618) (# "comment:\"FLAG tag\"" 1993) (# "comment:\"fused to GAL4 DNA-binding domain\"" 3270) (# "comment:\"fused to GAL4 activation domain\"" 3379)))
(less-frequent physical_interactions_mitab 26 (# (# "comment:\"45 unique peptides identified\"" 1) (# "comment:\"mRFP tag\"" 1) (# "comment:\"MBP tag, [3]H label\"" 1) (# "comment:\"AU5 tag\"" 1) (# "comment:\"fused to biotin\"" 1) (# "comment:\"isoform RA/D specific\"|comment:\"biotin label\"" 1) (# "comment:\"FLAG\"|comment:\"myc\"" 1)))
(most-frequent physical_interactions_mitab 27 (# (# "comment:\"TAP tag\"" 1285) (# "comment:\"HA tag\"" 1378) (# "comment:\"GST tag\"" 1497) (# "comment:\"FLAG tag\"" 2115) (# "comment:\"fused to GAL4 activation domain\"" 3309) (# "comment:\"fused to GAL4 DNA-binding domain\"" 3313)))
(less-frequent physical_interactions_mitab 27 (# (# "comment:\"XL isoform specific\"" 1) (# "comment:\"His,SUMO tag\"" 1) (# "comment:\"SAINT score = 0.9673\"" 1) (# "comment:\"fused to &bgr;-gal\"" 1) (# "comment:\"Myc tag\"|comment:\"RFP tag\"" 1) (# "comment:\"38, 33 peptide counts\"" 1) (# "comment:\"99 peptide counts\"" 1)))
(most-frequent physical_interactions_mitab 28 (# (# "comment:\"Source was embryos of wild-type fly line; bait produced from endogenous gene; prey produced from endogenous gene.\"" 984) (# "comment:\"Source was cell extract of S2 cell line; bait produced from transfected construct; prey produced from endogenous gene.\"" 1083) (# "comment:\"Source was cell extract of S2 cell line; bait produced from transfected construct; prey produced from transfected construct.\"" 1723) (# "comment:\"Source was yeast cell line; bait produced as transgenic fusion protein; prey produced as transgenic fusion protein.(Pooled)\"|comment:\"MORATORIUM:This data was made available \\'pre-publication\\' and, as such, its use is subject to the specific limitations described in FBrf0235788 for the period of 12 months. Moratorium expires on June 13, 2018.\"|comment:\"Two-hybrid system: yeast GAL4-BD/GAL4-AD\"" 1817) (# "comment:\"Source was yeast cell line; bait produced as transgenic fusion protein; prey produced as transgenic fusion protein.(Pairwise.)\"|comment:\"MORATORIUM:This data was made available \\'pre-publication\\' and, as such, its use is subject to the specific limitations described in FBrf0235788 for the period of 12 months. Moratorium expires on June 13, 2018.\"|comment:\"Two-hybrid system: yeast GAL4-BD/GAL4-AD\"" 1817) (# "comment:\"Source was yeast cell line; bait produced as transgenic fusion protein; prey produced as transgenic fusion protein (prey was previously cloned reagent).\"|comment:\"Two-hybrid system: yeast GAL4-BD/GAL4-AD\"" 2713) (# "comment:\"Source was embryos of wild-type fly line; proteins produced from endogenous genes.\"|comment:\"The structure of the Drosophila 80S ribosome with accessory proteins solved by cryo-EM. Complex captured as 3828 pairwise interactions which do not necessarily reflect direct contact.\"" 3403)))
(less-frequent physical_interactions_mitab 28 (# (# "comment:\"HGScore = 131.41663\"" 1) (# "comment:\"Interaction in vitro; bait produced as a recombinant fusion protein in bacterial system; prey produced as a recombinant fusion protein in bacterial system.\"|comment:\"@BicD@ binds to GTP-bound @Rab6@, not GDP-bound @Rab6@.\"|comment:\"Purified recombinant proteins were tested for interaction.\"|comment:\"There is overlap of @egl@ and @Rab6@ binding sites in @BicD@.\"" 1) (# "comment:\"Interaction in vitro; bait produced as a recombinant fusion protein in bacterial system; prey derived from S2 cell extract (endogenous gene).\"|comment:\"Constitutively active (GTP-locked) form of Rab was used for pull down. Parallel pull downs performed for several Rabs proteins in this study. Yield was measured using spectral counts. A specificity score (S score) was calculated, where greater weight was given to interactions seen with fewer baits.\"|comment:\"Specificity S-score=11.86.\"" 1) (# "comment:\"HGScore = 81.66328\"" 1) (# "comment:\"Interaction in vitro; bait produced as a recombinant fusion protein in HEK293F cells; prey produced as a recombinant fusion protein in S2 cells.\"|comment:\"Kd = 4.66uM\"" 1) (# "comment:\"Source was intact S2 cells; proteins produced from transfected constructs.\"|comment:\"Unlabeled S2 cells expressing @Nrg@ were mixed with dye labeled S2 cells expressing @ed@, and the formation of cell clusters containing both @Nrg@ and @ed@ expressing cells was assayed by immunofluorescence.\"" 1) (# "comment:\"HGScore = 61.53800\"" 1)))
(most-frequent physical_interactions_mitab 29 ())
(less-frequent physical_interactions_mitab 29 ())
(most-frequent physical_interactions_mitab 30 ())
(less-frequent physical_interactions_mitab 30 ())
(most-frequent physical_interactions_mitab 31 ())
(less-frequent physical_interactions_mitab 31 ())
(most-frequent physical_interactions_mitab 32 ())
(less-frequent physical_interactions_mitab 32 ())
(most-frequent physical_interactions_mitab 33 ())
(less-frequent physical_interactions_mitab 33 ())
(most-frequent physical_interactions_mitab 34 ())
(less-frequent physical_interactions_mitab 34 ())
(most-frequent physical_interactions_mitab 35 ())
(less-frequent physical_interactions_mitab 35 ())
(most-frequent physical_interactions_mitab 36 (# (# FALSE 16383) (# False 34863)))
(less-frequent physical_interactions_mitab 36 (# (# FALSE 16383) (# False 34863)))
(most-frequent physical_interactions_mitab 37 ())
(less-frequent physical_interactions_mitab 37 ())
(most-frequent physical_interactions_mitab 38 ())
(less-frequent physical_interactions_mitab 38 ())
(most-frequent physical_interactions_mitab 39 ())
(less-frequent physical_interactions_mitab 39 ())
(most-frequent physical_interactions_mitab 40 ())
(less-frequent physical_interactions_mitab 40 ())
(most-frequent physical_interactions_mitab 41 ())
(less-frequent physical_interactions_mitab 41 ())
(most-frequent physical_interactions_mitab 42 ())
(less-frequent physical_interactions_mitab 42 ())
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/scRNA-Seq_gene_expression_fb_2023_04.tsv
!(file-name scRNA-Seq_gene_expression  data/ftp.flybase.net/releases/current/precomputed_files/genes/scRNA-Seq_gene_expression_fb_2023_04.tsv)
(num-columns scRNA-Seq_gene_expression 15)
(duplicated-rows scRNA-Seq_gene_expression 0)
(total-rows scRNA-Seq_gene_expression 14319160)
(unique-values scRNA-Seq_gene_expression 1 13 object)
(unique-values scRNA-Seq_gene_expression 2 13 object)
(unique-values scRNA-Seq_gene_expression 3 89 object)
(unique-values scRNA-Seq_gene_expression 4 89 object)
(unique-values scRNA-Seq_gene_expression 5 4 object)
(unique-values scRNA-Seq_gene_expression 6 2 object)
(unique-values scRNA-Seq_gene_expression 7 29 object)
(unique-values scRNA-Seq_gene_expression 8 1690 object)
(unique-values scRNA-Seq_gene_expression 9 1690 object)
(unique-values scRNA-Seq_gene_expression 10 271 object)
(unique-values scRNA-Seq_gene_expression 11 271 object)
(unique-values scRNA-Seq_gene_expression 12 14295 object)
(unique-values scRNA-Seq_gene_expression 13 14295 object)
(unique-values scRNA-Seq_gene_expression 14 8174166 float64)
(unique-values scRNA-Seq_gene_expression 15 370225 float64)
(missing-values scRNA-Seq_gene_expression 1 0 () ())
(missing-values scRNA-Seq_gene_expression 2 0 () ())
(missing-values scRNA-Seq_gene_expression 3 0 () ())
(missing-values scRNA-Seq_gene_expression 4 0 () ())
(null-value-count scRNA-Seq_gene_expression 5 "" 5898802)
(missing-values scRNA-Seq_gene_expression 5 5898802 (# "") (# 5898802))
(missing-values scRNA-Seq_gene_expression 6 0 () ())
(missing-values scRNA-Seq_gene_expression 7 0 () ())
(missing-values scRNA-Seq_gene_expression 8 0 () ())
(missing-values scRNA-Seq_gene_expression 9 0 () ())
(missing-values scRNA-Seq_gene_expression 10 0 () ())
(missing-values scRNA-Seq_gene_expression 11 0 () ())
(missing-values scRNA-Seq_gene_expression 12 0 () ())
(missing-values scRNA-Seq_gene_expression 13 0 () ())
(missing-values scRNA-Seq_gene_expression 14 0 () ())
(missing-values scRNA-Seq_gene_expression 15 0 () ())
(most-frequent scRNA-Seq_gene_expression 1 (# (# FBrf0244302 177088) (# FBrf0245499 181659) (# FBrf0246655 191489) (# FBrf0247762 424264) (# FBrf0251482 602328) (# FBrf0249767 664303) (# FBrf0252876 11562417)))
(less-frequent scRNA-Seq_gene_expression 1 (# (# FBrf0248210 24480) (# FBrf0245988 38144) (# FBrf0245616 100103) (# FBrf0248439 114659) (# FBrf0247435 116094) (# FBrf0247148 122132) (# FBrf0244302 177088)))
(most-frequent scRNA-Seq_gene_expression 2 (# (# "Brunet Avalos et al., 2019, eLife 8: e50354" 177088) (# "Allen et al., 2020, eLife 9: e54074" 181659) (# "Cho et al., 2020, Nat. Commun. 11(1): 4483" 191489) (# "\u00d6zel et al., 2021, Nature 589(7840): 88--95" 424264) (# "Baker et al., 2021, Genome Res. 31(10): 1927--1937" 602328) (# "Mokashi et al., 2021, Front. Psychiatry 12: 699033" 664303) (# "Li et al., 2022, Science 375(6584): eabk2432" 11562417)))
(less-frequent scRNA-Seq_gene_expression 2 (# (# "Shi et al., 2021, Curr. Biol. 31(4): 840--852.e5" 24480) (# "Cattenoz et al., 2020, EMBO J. 39(12): e104486" 38144) (# "Jevitt et al., 2020, PLoS Biol. 18(4): e3000538" 100103) (# "Tauc et al., 2021, eLife 10: e62250" 114659) (# "Zappia et al., 2020, EMBO Rep. 21(10): e49555" 116094) (# "Rust et al., 2020, Nat. Commun. 11(1): 5628" 122132) (# "Brunet Avalos et al., 2019, eLife 8: e50354" 177088)))
(most-frequent scRNA-Seq_gene_expression 3 (# (# FBlc0005662 424264) (# FBlc0004310 462839) (# FBlc0003849 485904) (# FBlc0004788 587089) (# FBlc0004142 1324076) (# FBlc0004624 1374828) (# FBlc0005151 1787268)))
(less-frequent scRNA-Seq_gene_expression 3 (# (# FBlc0004140 11271) (# FBlc0004136 11650) (# FBlc0004622 12336) (# FBlc0004618 12504) (# FBlc0005149 13127) (# FBlc0005145 13237) (# FBlc0003731 16857)))
(most-frequent scRNA-Seq_gene_expression 4 (# (# "scRNAseq_2021_Ozel_ADM1_seq_clustering" 424264) (# "scRNAseq_2022_FCA_MALE_HEAD_seq_clustering" 462839) (# "scRNAseq_2022_FCA_FEMALE_HEAD_seq_clustering" 485904) (# "scRNAseq_2022_FCA_MIXED_HEAD_seq_clustering" 587089) (# "scRNAseq_2022_FCA_FEMALE_FULL_seq_clustering" 1324076) (# "scRNAseq_2022_FCA_MALE_FULL_seq_clustering" 1374828) (# "scRNAseq_2022_FCA_MIXED_FULL_seq_clustering" 1787268)))
(less-frequent scRNA-Seq_gene_expression 4 (# (# "scRNAseq_2022_FCA_FEMALE_IPC_seq_clustering" 11271) (# "scRNAseq_2022_FCA_FEMALE_CC_seq_clustering" 11650) (# "scRNAseq_2022_FCA_MALE_IPC_seq_clustering" 12336) (# "scRNAseq_2022_FCA_MALE_CC_seq_clustering" 12504) (# "scRNAseq_2022_FCA_MIXED_IPC_seq_clustering" 13127) (# "scRNAseq_2022_FCA_MIXED_CC_seq_clustering" 13237) (# "scRNAseq_2020_Cattenoz_NI_seq_clustering" 16857)))
(most-frequent scRNA-Seq_gene_expression 5 (# (# mixed 445126) (# female 3955616) (# male 4019616)))
(less-frequent scRNA-Seq_gene_expression 5 (# (# mixed 445126) (# female 3955616) (# male 4019616)))
(most-frequent scRNA-Seq_gene_expression 6 (# (# "larval stage" 522815) (# "adult stage" 13796345)))
(less-frequent scRNA-Seq_gene_expression 6 (# (# "larval stage" 522815) (# "adult stage" 13796345)))
(most-frequent scRNA-Seq_gene_expression 7 (# (# antenna 537963) (# ovary 556379) (# "adult brain" 602328) (# brain 664303) (# adult 1157530) (# "adult head" 1535832) (# mixed 4486172)))
(less-frequent scRNA-Seq_gene_expression 7 (# (# "adult pars intercerebralis" 36734) (# "adult corpus cardiacum" 37391) (# "embryonic/larval hemolymph" 101153) (# "adult midgut" 114659) (# "wing disc" 116094) (# "adult abdomen" 120557) (# "primary lobe of embryonic/larval lymph gland" 128480)))
(most-frequent scRNA-Seq_gene_expression 8 (# (# FBlc0004677 13868) (# FBlc0005192 13876) (# FBlc0004567 13941) (# FBlc0005094 13941) (# FBlc0004713 13953) (# FBlc0005247 13956) (# FBlc0005205 13958)))
(less-frequent scRNA-Seq_gene_expression 8 (# (# FBlc0003842 762) (# FBlc0003779 765) (# FBlc0003749 872) (# FBlc0003748 1065) (# FBlc0003833 1100) (# FBlc0003843 2232) (# FBlc0003733 2255)))
(most-frequent scRNA-Seq_gene_expression 9 (# (# "scRNAseq_2022_FCA_MALE_FULL_seq_clustering_fat_cells" 13868) (# "scRNAseq_2022_FCA_MIXED_FULL_seq_clustering_neurons" 13876) (# "scRNAseq_2022_FCA_MALE_TESTIS_seq_clustering_spermatocytes" 13941) (# "scRNAseq_2022_FCA_MIXED_TESTIS_seq_clustering_spermatocytes" 13941) (# "scRNAseq_2022_FCA_MALE_FULL_seq_clustering_spermatocytes" 13953) (# "scRNAseq_2022_FCA_MIXED_FULL_seq_clustering_spermatocytes" 13956) (# "scRNAseq_2022_FCA_MIXED_FULL_seq_clustering_fat_cells" 13958)))
(less-frequent scRNA-Seq_gene_expression 9 (# (# "scRNAseq_2020_Zappia_AmaRNAi_seq_clustering_imaginal_tracheoblasts" 762) (# "scRNAseq_2020_Cho_NI96HL_seq_clustering_lamellocytes" 765) (# "scRNAseq_2020_Cho_NI72LG_seq_clustering_lamellocytes" 872) (# "scRNAseq_2020_Cho_NI72LG_seq_clustering_adipohemocytes" 1065) (# "scRNAseq_2020_Zappia_mCherryRNAi_seq_clustering_imaginal_tracheoblasts" 1100) (# "scRNAseq_2020_Zappia_AmaRNAi_seq_clustering_SOP_cells" 2232) (# "scRNAseq_2020_Cattenoz_NI_seq_clustering_lamellocytes" 2255)))
(most-frequent scRNA-Seq_gene_expression 10 (# (# FBbt00003185 202803) (# FBbt00005040 281977) (# FBbt00047095 365976) (# FBbt00058143 371275) (# FBbt00058238 373508) (# FBbt00049949 395912) (# FBbt00058230 396390)))
(less-frequent scRNA-Seq_gene_expression 10 (# (# FBbt00003844 3363) (# FBbt00004868 4017) (# FBbt00003874 4103) (# FBbt00111746 4323) (# FBbt00004873 4476) (# FBbt00004905 4559) (# FBbt00003876 4893)))
(most-frequent scRNA-Seq_gene_expression 11 (# (# "adult oenocyte" 202803) (# "adult tracheocyte" 281977) (# "adult neuron" 365976) (# "adult hemocyte" 371275) (# "adult epithelial cell" 373508) (# "adult fat cell" 395912) (# "adult muscle cell" 396390)))
(less-frequent scRNA-Seq_gene_expression 11 (# (# "medullary tangential neuron Mt8" 3363) (# "germarium cap cell" 4017) (# "lobula columnar neuron LC4" 4103) (# "lobula columnar neuron LC10c" 4323) (# "female germline stem cell" 4476) (# "border follicle cell" 4559) (# "lobula columnar neuron LC6" 4893)))
(most-frequent scRNA-Seq_gene_expression 12 (# (# FBgn0267521 1690) (# FBgn0086472 1690) (# FBgn0002626 1690) (# FBgn0285947 1690) (# FBgn0003279 1690) (# FBgn0017579 1690) (# FBgn0016726 1690)))
(less-frequent scRNA-Seq_gene_expression 12 (# (# FBgn0284232 2) (# FBgn0267889 4) (# FBgn0045478 4) (# FBgn0039374 4) (# FBgn0028537 4) (# FBgn0267886 4) (# FBgn0085252 4)))
(most-frequent scRNA-Seq_gene_expression 13 (# (# "18SrRNA-Psi:CR45861" 1690) (# RpS25 1690) (# RpL32 1690) (# RpS10b 1690) (# RpL4 1690) (# RpL14 1690) (# RpL29 1690)))
(less-frequent scRNA-Seq_gene_expression 13 (# (# CG46316 2) (# CR46177 4) (# Gr64b 4) (# CG17770 4) (# CG31775 4) (# CR46174 4) (# CG34223 4)))
(most-frequent scRNA-Seq_gene_expression 14 (# (# 1272.2646 2315) (# 1218.0267 2325) (# 1287.0013 2439) (# 1298.7013 2444) (# 1095.2902 2445) (# 24.43136 2546) (# 1191.8951 2690)))
(less-frequent scRNA-Seq_gene_expression 14 (# (# 269.05170000000004 1) (# 480.440107 1) (# 990.35309 1) (# 370.235704 1) (# 272.274411 1) (# 234.056368 1) (# 320.438443 1)))
(most-frequent scRNA-Seq_gene_expression 15 (# (# 0.076923 41235) (# 0.0625 43249) (# 0.1 44120) (# 0.025 44512) (# 0.04 47158) (# 0.083333 47452) (# 0.05 59787)))
(less-frequent scRNA-Seq_gene_expression 15 (# (# 0.366282 1) (# 0.774026 1) (# 0.318802 1) (# 0.173431 1) (# 0.334605 1) (# 0.770109 1) (# 0.517905 1)))







;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/sed5CWUTK
!(file-name sed5C  data/ftp.flybase.net/releases/current/precomputed_files/genes/sed5CWUTK)
(num-columns sed5C 11)
(duplicated-rows sed5C 0)
(total-rows sed5C 120)
(unique-values sed5C 1 10 object)
(unique-values sed5C 2 10 object)
(unique-values sed5C 3 5 object)
(unique-values sed5C 4 6 object)
(unique-values sed5C 5 3 object)
(unique-values sed5C 6 2 object)
(unique-values sed5C 7 119 object)
(unique-values sed5C 8 119 object)
(unique-values sed5C 9 79 object)
(unique-values sed5C 10 2 object)
(unique-values sed5C 11 2 object)
(missing-values sed5C 1 0 () ())
(missing-values sed5C 2 0 () ())
(missing-values sed5C 3 0 () ())
(missing-values sed5C 4 0 () ())
(null-value-count sed5C 5 "" 114)
(missing-values sed5C 5 114 (# "") (# 114))
(null-value-count sed5C 6 "" 118)
(missing-values sed5C 6 118 (# "") (# 118))
(missing-values sed5C 7 0 () ())
(missing-values sed5C 8 0 () ())
(null-value-count sed5C 9 "" 41)
(missing-values sed5C 9 41 (# "") (# 41))
(null-value-count sed5C 10 "" 118)
(missing-values sed5C 10 118 (# "") (# 118))
(null-value-count sed5C 11 "" 118)
(missing-values sed5C 11 118 (# "") (# 118))
(most-frequent sed5C 1 (# (# FBgg0000062 3) (# FBgg0000072 4) (# FBgg0000040 5) (# FBgg0000081 6) (# FBgg0000100 7) (# FBgg0000118 14) (# FBgg0000128 75)))
(less-frequent sed5C 1 (# (# FBgg0000117 1) (# FBgg0000104 2) (# FBgg0000062 3) (# FBgg0000114 3) (# FBgg0000072 4) (# FBgg0000040 5) (# FBgg0000081 6)))
(most-frequent sed5C 2 (# (# "ROC UBIQUITIN LIGASES" 3) (# "ADAM METALLOPROTEASES" 4) (# "RING-BETWEEN-RING UBIQUITIN LIGASES" 5) (# "STRUCTURAL MAINTENANCE OF CHROMOSOMES GENE FAMILY" 6) (# CASPASES 7) (# "HECT UBIQUITIN LIGASES" 14) (# "UNCLASSIFIED RING DOMAIN UBIQUITIN LIGASES" 75)))
(less-frequent sed5C 2 (# (# "JOSEPHIN DEUBIQUITINASES" 1) (# "GOLIATH UBIQUITIN LIGASES" 2) (# "ROC UBIQUITIN LIGASES" 3) (# "N-ETHYLMALEIMIDE-SENSITIVE FACTORS" 3) (# "ADAM METALLOPROTEASES" 4) (# "RING-BETWEEN-RING UBIQUITIN LIGASES" 5) (# "STRUCTURAL MAINTENANCE OF CHROMOSOMES GENE FAMILY" 6)))
(most-frequent sed5C 3 (# (# "GO:0004843" 1) (# "GO:0004222" 4) (# "GO:0097153" 7) (# "GO:0016887" 9) (# "GO:0061630" 99)))
(less-frequent sed5C 3 (# (# "GO:0004843" 1) (# "GO:0004222" 4) (# "GO:0097153" 7) (# "GO:0016887" 9) (# "GO:0061630" 99)))
(most-frequent sed5C 4 (# (# ubiquit 1) (# "cysteine-type deubiquitinase activity" 1) (# "metalloendopeptidase activity" 4) (# "cysteine-type endopeptidase activity involved in apoptotic process" 7) (# "ATP hydrolysis activity" 9) (# "ubiquitin protein ligase activity" 98)))
(less-frequent sed5C 4 (# (# "cysteine-type deubiquitinase activity" 1) (# ubiquit 1) (# "metalloendopeptidase activity" 4) (# "cysteine-type endopeptidase activity involved in apoptotic process" 7) (# "ATP hydrolysis activity" 9) (# "ubiquitin protein ligase activity" 98)))
(most-frequent sed5C 5 (# (# "3.4.19.12" 1) (# "3.4.24.-" 4)))
(less-frequent sed5C 5 (# (# "3.4.19.12" 1) (# "3.4.24.-" 4)))
(most-frequent sed5C 6 (# (# "ubiquitinyl hydrolase 1" 1)))
(less-frequent sed5C 6 (# (# "ubiquitinyl hydrolase 1" 1)))
(most-frequent sed5C 7 (# (# FBgn0034546 1) (# FBgn0034573 1) (# FBgn0035024 1) (# FBgn0035232 1) (# FBgn0035233 1) (# FBgn0032635 1) (# FBgn0025186 1)))
(less-frequent sed5C 7 (# (# FBgn0025186 1) (# FBgn0035232 1) (# FBgn0035024 1) (# FBgn0034573 1) (# FBgn0034546 1) (# FBgn0034314 1) (# FBgn0034312 1)))
(most-frequent sed5C 8 (# (# CG13442 1) (# Sou 1) (# CG11414 1) (# CG12099 1) (# Pex10 1) (# CG15141 1) (# "ari-2" 1)))
(less-frequent sed5C 8 (# (# "ari-2" 1) (# CG12099 1) (# CG11414 1) (# Sou 1) (# CG13442 1) (# nopo 1) (# CG10916 1)))
(most-frequent sed5C 9 (# (# "Ubr1 ubiquitin ligase" 1) (# "Peroxin 12" 1) (# "Ring finger and CHY zinc finger domain containing 1" 1) (# "Non-SMC element 1" 1) (# "Protein interacting with Ttk69 and Sin3A" 1) (# "ariadne 2" 1)))
(less-frequent sed5C 9 (# (# "ariadne 2" 1) (# "Ring finger and CHY zinc finger domain containing 1" 1) (# "Peroxin 12" 1) (# "Ubr1 ubiquitin ligase" 1) (# "suppression of retinal degeneration disease 1 upon overexpression 1" 1) (# highwire 1) (# "Mahogunin ring finger 1" 1)))
(most-frequent sed5C 10 (# (# "3.4.19.12" 1)))
(less-frequent sed5C 10 (# (# "3.4.19.12" 1)))
(most-frequent sed5C 11 (# (# "ubiquitinyl hydrolase 1" 1)))
(less-frequent sed5C 11 (# (# "ubiquitinyl hydrolase 1" 1)))
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/genes/sednJUylZ
!(file-name sednJ  data/ftp.flybase.net/releases/current/precomputed_files/genes/sednJUylZ)
(num-columns sednJ 2)
(duplicated-rows sednJ 0)
(total-rows sednJ 76447)
(unique-values sednJ 1 76447 object)
(unique-values sednJ 2 76447 object)
(missing-values sednJ 1 0 () ())
(missing-values sednJ 2 0 () ())
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/go/gene_association.fb
!(file-name gene_associatio  data/ftp.flybase.net/releases/current/precomputed_files/go/gene_association.fb)
(num-columns gene_associatio 2)
(duplicated-rows gene_associatio 69)
(total-rows gene_associatio 48039)
(unique-values gene_associatio 1 47970 object)
(unique-values gene_associatio 2 4664 object)
(missing-values gene_associatio 1 0 () ())
(missing-values gene_associatio 2 0 () ())
(most-frequent gene_associatio 1 (# (# "FB\tFBgn0053817\tHis2A:CG33817\tinvolved_in\tGO:0006325\tFB:FBrf0255270|GO_REF:0000024\tISS\tMGI:MGI:2448285\tP\tHis2A:CG33817\tCG33817\tprotein\ttaxon:7227\t20160225\tFlyBase\t\t" 2) (# "FB\tFBgn0053817\tHis2A:CG33817\tpart_of\tGO:0000786\tFB:FBrf0255270|GO_REF:0000024\tISS\tUniProtKB:Q7L7L0\tC\tHis2A:CG33817\tCG33817\tprotein\ttaxon:7227\t20160225\tFlyBase\t\t" 2) (# "FB\tFBgn0053829\tHis2A:CG33829\tinvolved_in\tGO:0006325\tFB:FBrf0255270|GO_REF:0000024\tISS\tMGI:MGI:2448285\tP\tHis2A:CG33829\tCG33829\tprotein\ttaxon:7227\t20160225\tFlyBase\t\t" 2) (# "FB\tFBgn0053829\tHis2A:CG33829\tpart_of\tGO:0000786\tFB:FBrf0255270|GO_REF:0000024\tISS\tUniProtKB:Q7L7L0\tC\tHis2A:CG33829\tCG33829\tprotein\ttaxon:7227\t20160225\tFlyBase\t\t" 2) (# "FB\tFBgn0053829\tHis2A:CG33829\tenables\tGO:0003677\tFB:FBrf0255270|GO_REF:0000024\tISS\tUniProtKB:Q7L7L0\tF\tHis2A:CG33829\tCG33829\tprotein\ttaxon:7227\t20160225\tFlyBase\t\t" 2) (# "FB\tFBgn0053846\tHis1:CG33846\tpart_of\tGO:0000785\tFB:FBrf0255270|GO_REF:0000024\tISS\tUniProtKB:P07305\tC\tHis1:CG33846\tCG33846\tprotein\ttaxon:7227\t20161201\tFlyBase\t\t" 2) (# "FB\tFBgn0053843\tHis1:CG33843\tpart_of\tGO:0000785\tFB:FBrf0255270|GO_REF:0000024\tISS\tUniProtKB:P07305\tC\tHis1:CG33843\tCG33843\tprotein\ttaxon:7227\t20161201\tFlyBase\t\t" 2)))
(less-frequent gene_associatio 1 (# (# "!generated-by:" 1) (# "FB\tFBgn0027508\tTnks\tinvolved_in\tGO:1904355\tFB:FBrf0239784|PMID:21873635\tIBA\tPANTHER:PTN000652929\tP\ttankyrase\tBcDNA:LD22548|CG17487|CG4719|DTNKS|Dm.pARTb|TNKS|Tankyrase|TkrsIR|dARTD5|dTANK|dTNKS|dTankyrase\tprotein\ttaxon:7227\t20170420\tGO_Central\t\t" 1) (# "FB\tFBgn0027508\tTnks\tinvolved_in\tGO:0070198\tFB:FBrf0239784|PMID:21873635\tIBA\tPANTHER:PTN000652929\tP\ttankyrase\tBcDNA:LD22548|CG17487|CG4719|DTNKS|Dm.pARTb|TNKS|Tankyrase|TkrsIR|dARTD5|dTANK|dTNKS|dTankyrase\tprotein\ttaxon:7227\t20170420\tGO_Central\t\t" 1) (# "FB\tFBgn0027508\tTnks\tenables\tGO:0003950\tFB:FBrf0241717|PMID:30593492\tIMP\t\tF\ttankyrase\tBcDNA:LD22548|CG17487|CG4719|DTNKS|Dm.pARTb|TNKS|Tankyrase|TkrsIR|dARTD5|dTANK|dTNKS|dTankyrase\tprotein\ttaxon:7227\t20190806\tFlyBase\t\t" 1) (# "FB\tFBgn0027508\tTnks\tinvolved_in\tGO:0090263\tFB:FBrf0241717|PMID:30593492\tIMP\t\tP\ttankyrase\tBcDNA:LD22548|CG17487|CG4719|DTNKS|Dm.pARTb|TNKS|Tankyrase|TkrsIR|dARTD5|dTANK|dTNKS|dTankyrase\tprotein\ttaxon:7227\t20190806\tFlyBase\t\t" 1) (# "FB\tFBgn0027508\tTnks\tinvolved_in\tGO:0032436\tFB:FBrf0241717|PMID:30593492\tIMP\t\tP\ttankyrase\tBcDNA:LD22548|CG17487|CG4719|DTNKS|Dm.pARTb|TNKS|Tankyrase|TkrsIR|dARTD5|dTANK|dTNKS|dTankyrase\tprotein\ttaxon:7227\t20190806\tFlyBase\t\t" 1) (# "FB\tFBgn0027508\tTnks\tinvolved_in\tGO:0046330\tFB:FBrf0254888|PMID:36222503\tIDA\t\tP\ttankyrase\tBcDNA:LD22548|CG17487|CG4719|DTNKS|Dm.pARTb|TNKS|Tankyrase|TkrsIR|dARTD5|dTANK|dTNKS|dTankyrase\tprotein\ttaxon:7227\t20230307\tFlyBase\t\t" 1)))
(most-frequent gene_associatio 2 (# (# "sex|dsxF|dsxM|intersex-62c|ix-62c\tprotein\ttaxon:7227\t20060803\tFlyBase\t\t" 19) (# "lipase\tprotein\ttaxon:7227\t20230703\tInterPro\t\t" 19) (# "factor|A7.1|ABF|Abf|CG3992|DmGATAb|GATA|GATAb|SERPENT|SRP|Serpent|Srp|abf|dGATAb|l(3)01549|l(3)89B2|l(3)neo45|serpentD|spt|srpD\tprotein\ttaxon:7227\t20060803\tFlyBase\t\t" 21) (# "protein\tprotein\ttaxon:7227\t20151015\tFlyBase\t\t" 21) (# "sterile(2)ltoRJ36|fs(2)ltoRJ36|no-relish\tprotein\ttaxon:7227\t20060803\tFlyBase\t\t" 23) (# "1|Rhomboid-1|Rhomboid-I|Ve|Veinlet|iks|rho-1|rho1|rhom|rhomboid-1|rhomboid/veinlet|rhomboid1|ve|veinlet\tprotein\ttaxon:7227\t20200406\tFlyBase\t\t" 26) (# "1.12|co|dNotch|fa|facet|l(1)3Cb|l(1)Ax|l(1)N|n[fah]|nd|notch|notchoid|shd|spl|split|strawberry|swb\tprotein\ttaxon:7227\t20060803\tFlyBase\t\t" 44)))
(less-frequent gene_associatio 2 (# (# FlyBase 1) (# "B2-3|Sox21|SoxB2.3|sox21a\tprotein\ttaxon:7227\t20221006\tGO_Central\t\t" 1) (# "B2-2|Sox21B|SoxB2.2|sox-like\tprotein\ttaxon:7227\t20200725\tGO_Central\t\t" 1) (# "B2-2|Sox21B|SoxB2.2|sox-like\tprotein\ttaxon:7227\t20200311\tGO_Central\t\t" 1) (# "B2-2|Sox21B|SoxB2.2|sox-like\tprotein\ttaxon:7227\t20221006\tGO_Central\t\t" 1) (# "212\tCG33329|ORE-5|SP212\tprotein\ttaxon:7227\t20060803\tFlyBase\t\t" 1) (# "212\tCG33329|ORE-5|SP212\tprotein\ttaxon:7227\t20190311\tFlyBase\t\t" 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/human_disease/disease_model_annotations_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/human_disease/disease_model_annotations_fb_2023_04.tsv
!(file-name disease_model_annotations  data/ftp.flybase.net/releases/current/precomputed_files/human_disease/disease_model_annotations_fb_2023_04.tsv)
(num-columns disease_model_annotations 12)
(duplicated-rows disease_model_annotations 0)
(total-rows disease_model_annotations 26750)
(unique-values disease_model_annotations 1 5165 object)
(unique-values disease_model_annotations 2 5165 object)
(unique-values disease_model_annotations 3 317 object)
(unique-values disease_model_annotations 4 6 object)
(unique-values disease_model_annotations 5 3554 object)
(unique-values disease_model_annotations 6 3554 object)
(unique-values disease_model_annotations 7 8303 object)
(unique-values disease_model_annotations 8 8303 object)
(unique-values disease_model_annotations 9 2657 object)
(unique-values disease_model_annotations 10 2657 object)
(unique-values disease_model_annotations 11 6770 object)
(unique-values disease_model_annotations 12 2675 object)
(missing-values disease_model_annotations 1 0 () ())
(missing-values disease_model_annotations 2 0 () ())
(null-value-count disease_model_annotations 3 "" 21466)
(missing-values disease_model_annotations 3 21466 (# "") (# 21466))
(missing-values disease_model_annotations 4 0 () ())
(missing-values disease_model_annotations 5 0 () ())
(missing-values disease_model_annotations 6 0 () ())
(null-value-count disease_model_annotations 7 "" 6240)
(missing-values disease_model_annotations 7 6240 (# "") (# 6240))
(null-value-count disease_model_annotations 8 "" 6240)
(missing-values disease_model_annotations 8 6240 (# "") (# 6240))
(null-value-count disease_model_annotations 9 "" 20510)
(missing-values disease_model_annotations 9 20510 (# "") (# 20510))
(null-value-count disease_model_annotations 10 "" 20510)
(missing-values disease_model_annotations 10 20510 (# "") (# 20510))
(missing-values disease_model_annotations 11 0 () ())
(missing-values disease_model_annotations 12 0 () ())
(most-frequent disease_model_annotations 1 (# (# FBgn0026420 300) (# FBgn0029891 301) (# FBgn0261084 371) (# FBgn0024961 448) (# FBgn0025823 630) (# FBgn0025587 680) (# FBgn0015394 948)))
(less-frequent disease_model_annotations 1 (# (# FBgn0033093 1) (# FBgn0031951 1) (# FBgn0031971 1) (# FBgn0031973 1) (# FBgn0266724 1) (# FBgn0050273 1) (# FBgn0031981 1)))
(most-frequent disease_model_annotations 2 (# (# "Hsap\\SNCA" 300) (# Pink1 301) (# "Hsap\\TARDBP" 371) (# "Hsap\\ATXN3" 448) (# "Hsap\\APP" 630) (# "Hsap\\HTT" 680) (# "Hsap\\MAPT" 948)))
(less-frequent disease_model_annotations 2 (# (# CG3270 1) (# r2d2 1) (# Sirup 1) (# Spn28Dc 1) (# Trs20 1) (# CG30273 1) (# Megf8 1)))
(most-frequent disease_model_annotations 3 (# (# "HGNC:11138" 300) (# "HGNC:11571" 371) (# "HGNC:7106" 448) (# "HGNC:620" 630) (# "HGNC:4851" 680) (# "HGNC:6893" 948)))
(less-frequent disease_model_annotations 3 (# (# "HGNC:6239" 1) (# "HGNC:16854" 1) (# "HGNC:11118" 1) (# "HGNC:12013" 1) (# "HGNC:18222" 1) (# "HGNC:14973" 1) (# "HGNC:19245" 1)))
(most-frequent disease_model_annotations 4 (# (# "DOES NOT exacerbate" 21) (# "DOES NOT ameliorate" 106) (# "DOES NOT model" 135) (# exacerbates 2650) (# ameliorates 4360) (# "model of" 19478)))
(less-frequent disease_model_annotations 4 (# (# "DOES NOT exacerbate" 21) (# "DOES NOT ameliorate" 106) (# "DOES NOT model" 135) (# exacerbates 2650) (# ameliorates 4360) (# "model of" 19478)))
(most-frequent disease_model_annotations 5 (# (# "DOID:10652" 652) (# "DOID:0060213" 692) (# "DOID:14330" 992) (# "DOID:1289" 1045) (# "DOID:12858" 1091) (# "DOID:162" 1305) (# "DOID:680" 1474)))
(less-frequent disease_model_annotations 5 (# (# "DOID:0111040" 1) (# "DOID:0080232" 1) (# "DOID:0110441" 1) (# "DOID:0111706" 1) (# "DOID:0080698" 1) (# "DOID:0080465" 1) (# "DOID:0060730" 1)))
(most-frequent disease_model_annotations 6 (# (# "Alzheimer's disease" 652) (# "frontotemporal dementia and/or amyotrophic lateral sclerosis-1" 692) (# "Parkinson's disease" 992) (# "neurodegenerative disease" 1045) (# "Huntington's disease" 1091) (# cancer 1305) (# tauopathy 1474)))
(less-frequent disease_model_annotations 6 (# (# "glycogen storage disease IXd" 1) (# "autosomal dominant intellectual developmental disorder 51" 1) (# "dilated cardiomyopathy 2B" 1) (# "oblique facial clefting 1" 1) (# "Teebi hypertelorism syndrome 1" 1) (# "developmental and epileptic encephalopathy 30" 1) (# "torsion dystonia 1" 1)))
(most-frequent disease_model_annotations 7 (# (# FBal0060587 153) (# FBal0127292 173) (# FBal0193144 193) (# FBal0126526 233) (# FBal0126527 239) (# FBal0090630 296)))
(less-frequent disease_model_annotations 7 (# (# FBal0341584 1) (# FBal0265787 1) (# FBal0324663 1) (# FBal0262510 1) (# FBal0257944 1) (# FBal0235732 1) (# FBal0206026 1)))
(most-frequent disease_model_annotations 8 (# (# "Ras85D[V12.UAS]" 153) (# "Hsap\\HTT[Q93.ex1.UAS]" 173) (# "Pink1[B9]" 193) (# "Hsap\\MAPT[UAS.cWa]" 233) (# "Hsap\\MAPT[R406W.UAS]" 239) (# "Hsap\\ATXN3[tr.Q78.UAS.Tag:HA]" 296)))
(less-frequent disease_model_annotations 8 (# (# "Tom7[HMC06597]" 1) (# "Lkb1[UAS.cWa]" 1) (# "Lkb1[VSH330167]" 1) (# "Lkb1[GL00019]" 1) (# "Lkb1[HMS01351]" 1) (# "Lkb1[KK108675]" 1) (# "Droj2[GD14050]" 1)))
(most-frequent disease_model_annotations 9 (# (# "HGNC:6677" 34) (# "HGNC:2638" 35) (# "HGNC:9475" 36) (# "HGNC:59" 44) (# "HGNC:10024" 45) (# "HGNC:12530" 48)))
(less-frequent disease_model_annotations 9 (# (# "HGNC:26013" 1) (# "HGNC:7703" 1) (# "HGNC:24846" 1) (# "HGNC:5201" 1) (# "HGNC:8966" 1) (# "HGNC:12756" 1) (# "HGNC:12974" 1)))
(most-frequent disease_model_annotations 10 (# (# LPL 34) (# CYP3A5 35) (# PRSS1 36) (# ABCC8 44) (# RLBP1 45) (# UGT1A1 48)))
(less-frequent disease_model_annotations 10 (# (# DNAAF5 1) (# NDUFB8 1) (# GAS2L2 1) (# HS6ST1 1) (# PIGL 1) (# WDR4 1) (# RNF113A 1)))
(most-frequent disease_model_annotations 11 (# (# "modeled by FLYBASE:Hsap\\HTT[128Q.1-336.UAS]; FB:FBal0294194" 129) (# "modeled by FLYBASE:Hsap\\MAPT[UAS.cWa]; FB:FBal0126526" 181) (# "modeled by FLYBASE:Hsap\\MAPT[R406W.UAS]; FB:FBal0126527" 189) (# "modeled by FLYBASE:Hsap\\ATXN3[tr.Q78.UAS.Tag:HA]; FB:FBal0090630" 241) (# CEC 361) (# CEA 4981) (# IEA 6240)))
(less-frequent disease_model_annotations 11 (# (# "is exacerbated by FLYBASE:Pka-C1[GD1276]; FB:FBal0208081" 1) (# "is ameliorated by FLYBASE:wg[l-12]; FB:FBal0018504" 1) (# "is ameliorated by FLYBASE:nej[Q7]; FB:FBal0094386" 1) (# "is ameliorated by FLYBASE:mam[8]; FB:FBal0012016" 1) (# "is ameliorated by FLYBASE:gro[1]; FB:FBal0005217" 1) (# "is ameliorated by FLYBASE:fz[EY13696]; FB:FBal0159195" 1) (# "is ameliorated by FLYBASE:fng[52]; FB:FBal0034614" 1)))
(most-frequent disease_model_annotations 12 (# (# FBrf0228684 158) (# FBrf0241270 174) (# FBrf0248245 176) (# FBrf0244983 239) (# FBrf0227999 245) (# FBrf0218446 303) (# FBrf0241599 6240)))
(less-frequent disease_model_annotations 12 (# (# FBrf0217529 1) (# FBrf0230073 1) (# FBrf0205420 1) (# FBrf0190823 1) (# FBrf0221444 1) (# FBrf0211611 1) (# FBrf0194165 1)))


;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/insertions/construct_maps.zip
;; Error reading the file: Multiple files found in ZIP file. Only one file per ZIP: ['construct_maps/', 'construct_maps/FBmc0000107.png', 'construct_maps/FBmc0000117.png', 'construct_maps/FBmc0000133.png', 'construct_maps/FBmc0000135.png', 'construct_maps/FBmc0000136.png', 'construct_maps/FBmc0000137.png', 'construct_maps/FBmc0000138.png', 'construct_maps/FBmc0000166.png', 'construct_maps/FBmc0000167.png', 'construct_maps/FBmc0000168.png', 'construct_maps/FBmc0000169.png', 'construct_maps/FBmc0000170.png', 'construct_maps/FBmc0000171.png', 'construct_maps/FBmc0000172.png', 'construct_maps/FBmc0000175.png', 'construct_maps/FBmc0000176.png', 'construct_maps/FBmc0000177.png', 'construct_maps/FBmc0000178.png', 'construct_maps/FBmc0000179.png', 'construct_maps/FBmc0000180.png', 'construct_maps/FBmc0000187.png', 'construct_maps/FBmc0000192.png', 'construct_maps/FBmc0000214.png', 'construct_maps/FBmc0000215.png', 'construct_maps/FBmc0000216.png', 'construct_maps/FBmc0000217.png', 'construct_maps/FBmc0000218.png', 'construct_maps/FBmc0000223.png', 'construct_maps/FBmc0000224.png', 'construct_maps/FBmc0000225.png', 'construct_maps/FBmc0000226.png', 'construct_maps/FBmc0000227.png', 'construct_maps/FBmc0000228.png', 'construct_maps/FBmc0000230.png', 'construct_maps/FBmc0000231.png', 'construct_maps/FBmc0000232.png', 'construct_maps/FBmc0000234.png', 'construct_maps/FBmc0000271.png', 'construct_maps/FBmc0000278.png', 'construct_maps/FBmc0000279.png', 'construct_maps/FBmc0000286.png', 'construct_maps/FBmc0000294.png', 'construct_maps/FBmc0000331.png', 'construct_maps/FBmc0000334.png', 'construct_maps/FBmc0000352.png', 'construct_maps/FBmc0000353.png', 'construct_maps/FBmc0000354.png', 'construct_maps/FBmc0000355.png', 'construct_maps/FBmc0000373.png', 'construct_maps/FBmc0000376.png', 'construct_maps/FBmc0000380.png', 'construct_maps/FBmc0000381.png', 'construct_maps/FBmc0000383.png', 'construct_maps/FBmc0000384.png', 'construct_maps/FBmc0000461.png', 'construct_maps/FBmc0000600.png', 'construct_maps/FBmc0000727.png', 'construct_maps/FBmc0000728.png', 'construct_maps/FBmc0000913.png', 'construct_maps/FBmc0000938.png', 'construct_maps/FBmc0000960.png', 'construct_maps/FBmc0000961.png', 'construct_maps/FBmc0000965.png', 'construct_maps/FBmc0000970.png', 'construct_maps/FBmc0001073.png', 'construct_maps/FBmc0001075.png', 'construct_maps/FBmc0001078.png', 'construct_maps/FBmc0001079.png', 'construct_maps/FBmc0001083.png', 'construct_maps/FBmc0001086.png', 'construct_maps/FBmc0001087.png', 'construct_maps/FBmc0001179.png', 'construct_maps/FBmc0001367.png', 'construct_maps/FBmc0001376.png', 'construct_maps/FBmc0001379.png', 'construct_maps/FBmc0001382.png', 'construct_maps/FBmc0001383.png', 'construct_maps/FBmc0001433.png', 'construct_maps/FBms0003205.png', 'construct_maps/FBtp0000039.png', 'construct_maps/FBtp0000047.png', 'construct_maps/FBtp0000078.png', 'construct_maps/FBtp0000081.png', 'construct_maps/FBtp0000082.png', 'construct_maps/FBtp0000153.png', 'construct_maps/FBtp0000154.png', 'construct_maps/FBtp0000155.png', 'construct_maps/FBtp0000156.png', 'construct_maps/FBtp0000157.png', 'construct_maps/FBtp0000160.png', 'construct_maps/FBtp0000161.png', 'construct_maps/FBtp0000162.png', 'construct_maps/FBtp0000163.png', 'construct_maps/FBtp0000164.png', 'construct_maps/FBtp0000165.png', 'construct_maps/FBtp0000177.png', 'construct_maps/FBtp0000190.png', 'construct_maps/FBtp0000191.png', 'construct_maps/FBtp0000192.png', 'construct_maps/FBtp0000193.png', 'construct_maps/FBtp0000194.png', 'construct_maps/FBtp0000195.png', 'construct_maps/FBtp0000196.png', 'construct_maps/FBtp0000197.png', 'construct_maps/FBtp0000198.png', 'construct_maps/FBtp0000199.png', 'construct_maps/FBtp0000200.png', 'construct_maps/FBtp0000201.png', 'construct_maps/FBtp0000203.png', 'construct_maps/FBtp0000204.png', 'construct_maps/FBtp0000206.png', 'construct_maps/FBtp0000207.png', 'construct_maps/FBtp0000208.png', 'construct_maps/FBtp0000209.png', 'construct_maps/FBtp0000210.png', 'construct_maps/FBtp0000242.png', 'construct_maps/FBtp0000249.png', 'construct_maps/FBtp0000250.png', 'construct_maps/FBtp0000261.png', 'construct_maps/FBtp0000267.png', 'construct_maps/FBtp0000307.png', 'construct_maps/FBtp0000310.png', 'construct_maps/FBtp0000345.png', 'construct_maps/FBtp0000348.png', 'construct_maps/FBtp0000352.png', 'construct_maps/FBtp0000354.png', 'construct_maps/FBtp0000355.png', 'construct_maps/FBtp0000423.png', 'construct_maps/FBtp0000488.png', 'construct_maps/FBtp0000549.png', 'construct_maps/FBtp0000729.png', 'construct_maps/FBtp0000905.png', 'construct_maps/FBtp0000906.png', 'construct_maps/FBtp0000910.png', 'construct_maps/FBtp0000913.png', 'construct_maps/FBtp0000928.png', 'construct_maps/FBtp0000929.png', 'construct_maps/FBtp0001056.png', 'construct_maps/FBtp0001057.png', 'construct_maps/FBtp0001058.png', 'construct_maps/FBtp0001059.png', 'construct_maps/FBtp0001061.png', 'construct_maps/FBtp0001062.png', 'construct_maps/FBtp0001067.png', 'construct_maps/FBtp0001070.png', 'construct_maps/FBtp0001071.png', 'construct_maps/FBtp0001075.png', 'construct_maps/FBtp0001080.png', 'construct_maps/FBtp0001082.png', 'construct_maps/FBtp0001083.png', 'construct_maps/FBtp0001084.png', 'construct_maps/FBtp0001089.png', 'construct_maps/FBtp0001092.png', 'construct_maps/FBtp0001094.png', 'construct_maps/FBtp0001097.png', 'construct_maps/FBtp0001403.png', 'construct_maps/FBtp0001435.png']
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/insertions/fu_gal4_table_fb_2023_04.json
!(file-name fu_gal4_table_  data/ftp.flybase.net/releases/current/precomputed_files/insertions/fu_gal4_table_fb_2023_04.json)
(num-columns fu_gal4_table_ 2)
(duplicated-rows fu_gal4_table_ 25810)
(total-rows fu_gal4_table_ 43801)
(unique-values fu_gal4_table_ 1 17987 object)
(unique-values fu_gal4_table_ 2 343 object)
(missing-values fu_gal4_table_ 1 0 () ())
(null-value-count fu_gal4_table_ 2 "" 2614)
(missing-values fu_gal4_table_ 2 2614 (# "") (# 2614))
(most-frequent fu_gal4_table_ 1 (# (# "      \"driver\": " 319) (# "    " 319) (# "      }" 319) (# "        \"major_stages\": " 319) (# "        \"transposons\": " 319) (# "        \"major_tissues\": " 319) (# "        }," 1580)))
(less-frequent fu_gal4_table_ 1 (# (# "  \"metaData\": " 1) (# "          \"FBst0067166\": \"67166\"," 1) (# "          \"FBst0067167\": \"67167\"," 1) (# "          \"FBst0067168\": \"67168\"," 1) (# "          \"FBst0067175\": \"67175\"," 1) (# "          \"FBst0067177\": \"67177\"," 1) (# "          \"FBst0067178\": \"67178\"," 1)))
(most-frequent fu_gal4_table_ 2 (# (# "GawB}fru<up>NP0021</up>\"" 1) (# "Or47b-GAL4.7.467}\"" 1) (# "ato-GAL4.3.6}\"" 1) (# "GAL4}pnt<up>14-94</up>\"" 1) (# "en2.4-GAL4}\"" 3) (# "}," 154)))
(less-frequent fu_gal4_table_ 2 (# (# "GawB}C587\"" 1) (# "GawB}fru<up>NP0021</up>\"" 1) (# "GMR9D11-GAL4}\"" 1) (# "alrm-GAL4.D}\"" 1) (# "GAL4-lacZ-Ubx(-FRT).dC}@; see @Scer\\\\GAL4[Ubx.PdC]@ elsewhere in this table.\"," 1) (# "GAL4-lacZ-Ubx(FRT.f<up>+</up>).dC}\"" 1) (# "GAL4-\u03b1Tub84B(-FRT).P}@; see @Scer\\\\GAL4[\u03b1Tub84B.PP]@ elsewhere in this table.\"" 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/insertions/insertion_mapping_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/insertions/insertion_mapping_fb_2023_04.tsv
!(file-name insertion_mapping  data/ftp.flybase.net/releases/current/precomputed_files/insertions/insertion_mapping_fb_2023_04.tsv)
(num-columns insertion_mapping 7)
(duplicated-rows insertion_mapping 92)
(total-rows insertion_mapping 212010)
(unique-values insertion_mapping 1 211918 object)
(unique-values insertion_mapping 2 211884 object)
(unique-values insertion_mapping 3 64780 object)
(unique-values insertion_mapping 4 3 object)
(unique-values insertion_mapping 5 4 object)
(unique-values insertion_mapping 6 7609 object)
(unique-values insertion_mapping 7 3716 object)
(missing-values insertion_mapping 1 0 () ())
(null-value-count insertion_mapping 2 "" 127)
(missing-values insertion_mapping 2 127 (# "") (# 127))
(null-value-count insertion_mapping 3 "" 139921)
(missing-values insertion_mapping 3 139921 (# "") (# 139921))












(null-value-count insertion_mapping 4 "" 139921)
(missing-values insertion_mapping 4 139921 (# "") (# 139921))
(null-value-count insertion_mapping 5 "" 139921)
(missing-values insertion_mapping 5 139921 (# "") (# 139921))
(null-value-count insertion_mapping 6 "" 129488)
(missing-values insertion_mapping 6 129488 (# "") (# 129488))
(null-value-count insertion_mapping 7 "" 203698)
(null-value-count insertion_mapping 7 "?" 70)


(missing-values insertion_mapping 7 203768 (# "" "?") (# 203698 70))
(most-frequent insertion_mapping 1 (# (# "P{Roc1b.+t1.17}" 4) (# "P{Mcp-wy" 4) (# "P{Fab7-w" 6) (# "P{SUPor-P.PRE" 9) (# "P{ush-lacZ.-2190.-1421}" 9) (# "P{Mcp-ff" 13) (# "P{Mcp-w" 44)))
(less-frequent insertion_mapping 1 (# (# "P{UASp-GAP43.mEos}1" 1) (# "P{KK106851}VIE-260B" 1) (# "P{KK106853}VIE-260B" 1) (# "P{KK106855}VIE-260B" 1) (# "P{KK106857}VIE-260B" 1) (# "P{KK106859}VIE-260B" 1) (# "P{KK106861}VIE-260B" 1)))
(most-frequent insertion_mapping 2 (# (# FBti0120120 1) (# FBti0120119 1) (# FBti0120118 1) (# FBti0120117 1) (# FBti0120126 1) (# FBti0129988 1)))
(less-frequent insertion_mapping 2 (# (# FBti0129988 1) (# FBti0120115 1) (# FBti0120116 1) (# FBti0120117 1) (# FBti0120118 1) (# FBti0120119 1) (# FBti0120120 1)))
(most-frequent insertion_mapping 3 (# (# "3L:4692761..4692761" 19) (# "3L:3250542..3250542" 20) (# "X:246305..246305" 21) (# "3R:31883471..31883471" 21) (# "2L:22237519..22237519" 37) (# "X:6861890..6861890" 53)))
(less-frequent insertion_mapping 3 (# (# "3R:5508394..5508394" 1) (# "3R:9353290..9353290" 1) (# "3R:8033496..8033496" 1) (# "2L:17260772..17260772" 1) (# "3L:540584..540584" 1) (# "3L:8360935..8360935" 1) (# "3L:11819914..11819914" 1)))

(most-frequent insertion_mapping 4 (# (# t 7054) (# f 65035)))
(less-frequent insertion_mapping 4 (# (# t 7054) (# f 65035)))
(most-frequent insertion_mapping 5 (# (# 0.0 10777) (# -1.0 26604) (# 1.0 34708)))
(less-frequent insertion_mapping 5 (# (# 0.0 10777) (# -1.0 26604) (# 1.0 34708)))

;; TODO
;;(most-frequent insertion_mapping 6 (# (# "100D2" 154) (# "47A11" 156) (# "53F8" 159) (# "35F1" 186) (# "35D1" 204) (# "2100.0" 208)))
;;(less-frequent insertion_mapping 6 (# (# "53B2-53B4" 1) (# "45C7-45C9" 1) (# "75B1-75B4" 1) (# "22E3-22E4" 1) (# "45C7-45C8" 1) (# "55F1-55F3" 1) (# 77F3 1)))
(most-frequent insertion_mapping 7 (# (# 75B 30) (# "12C1-12C2" 41) (# "35D1-35D2" 44) (# "21B4-21B6" 48) (# "47A11-47A14" 55)))
(less-frequent insertion_mapping 7 (# (# "59B4-59B5" 1) (# "79D1-79D4" 1) (# "50C4-50C5" 1) (# "60D5-60D6" 1) (# "47E4-47E5" 1) (# "47A1-47B14" 1) (# "46B13--46E4" 1)))






















;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/map_conversion/cyto-genetic-seq.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/map_conversion/cyto-genetic-seq.tsv
!(file-name cyto-genetic-seq  data/ftp.flybase.net/releases/current/precomputed_files/map_conversion/cyto-genetic-seq.tsv)
(num-columns cyto-genetic-seq 4)
(duplicated-rows cyto-genetic-seq 0)
(total-rows cyto-genetic-seq 600)
(unique-values cyto-genetic-seq 1 600 object)
(unique-values cyto-genetic-seq 2 292 object)
(unique-values cyto-genetic-seq 3 593 object)
(unique-values cyto-genetic-seq 4 8 object)
(missing-values cyto-genetic-seq 1 0 () ())
(missing-values cyto-genetic-seq 2 0 () ())
(null-value-count cyto-genetic-seq 3 "" 8)
(missing-values cyto-genetic-seq 3 8 (# "") (# 8))
(null-value-count cyto-genetic-seq 4 "" 577)
(missing-values cyto-genetic-seq 4 577 (# "") (# 577))
(most-frequent cyto-genetic-seq 2 (# (# "3-[43]" 7) (# "3-[47.5]" 7) (# "3-[48]" 10) (# "2-[55]" 13) (# "3-[45]" 17) (# "2-[54]" 24) (# "3-[47]" 24)))
(less-frequent cyto-genetic-seq 2 (# (# "3-[85]" 1) (# "3-[84]" 1) (# "3-[97]" 1) (# "3-[96]" 1) (# "3-[95]" 1) (# "2-[69]" 1) (# "2-[70]" 1)))
(most-frequent cyto-genetic-seq 3 (# (# "3L:10316396..10769950" 1) (# "3L:9865311..10316395" 1) (# "3L:9547270..9865310" 1) (# "3L:9333838..9547269" 1) (# "3L:11174026..11254920" 1) (# "X:408583..660483" 1)))
(less-frequent cyto-genetic-seq 3 (# (# "X:408583..660483" 1) (# "3L:8981731..9125749" 1) (# "3L:9125750..9333837" 1) (# "3L:9333838..9547269" 1) (# "3L:9547270..9865310" 1) (# "3L:9865311..10316395" 1) (# "3L:10316396..10769950" 1)))
(most-frequent cyto-genetic-seq 4 (# (# "includes 16 area(s) of non-identity" 1) (# "includes 24 area(s) of non-identity" 1) (# "failed to convert" 3) (# "in area of non-identity" 5) (# inversion 6) (# "includes 1 area of non-identity" 6)))
(less-frequent cyto-genetic-seq 4 (# (# "includes 24 area(s) of non-identity" 1) (# "includes 16 area(s) of non-identity" 1) (# "includes 6 area(s) of non-identity" 1) (# "failed to convert" 3) (# "in area of non-identity" 5) (# "includes 1 area of non-identity" 6) (# inversion 6)))
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/map_conversion/genome-cyto-seq.txt
!(file-name genome-cyto-seq  data/ftp.flybase.net/releases/current/precomputed_files/map_conversion/genome-cyto-seq.txt)
(num-columns genome-cyto-seq 3)
(duplicated-rows genome-cyto-seq 0)
(total-rows genome-cyto-seq 5033)
(unique-values genome-cyto-seq 1 5033 object)
(unique-values genome-cyto-seq 2 5033 int64)
(unique-values genome-cyto-seq 3 5033 int64)
(missing-values genome-cyto-seq 1 0 () ())
(missing-values genome-cyto-seq 2 0 () ())
(missing-values genome-cyto-seq 3 0 () ())

;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/metadata/dataset_metadata_fb_2023_04.tsv
!(file-name dataset_metadata  data/ftp.flybase.net/releases/current/precomputed_files/metadata/dataset_metadata_fb_2023_04.tsv)
(num-columns dataset_metadata 4)
(duplicated-rows dataset_metadata 0)
(total-rows dataset_metadata 22220266)
(unique-values dataset_metadata 1 3493 object)
(unique-values dataset_metadata 2 3493 object)
(unique-values dataset_metadata 3 1885456 object)
(unique-values dataset_metadata 4 1885453 object)
(missing-values dataset_metadata 1 0 () ())
(missing-values dataset_metadata 2 0 () ())
(missing-values dataset_metadata 3 0 () ())
(null-value-count dataset_metadata 4 "unknown" 1)
(missing-values dataset_metadata 4 1 (# unknown) (# 1))
(most-frequent dataset_metadata 1 (# (# FBlc0000146 67302) (# FBlc0000142 67302) (# FBlc0000143 67302) (# FBlc0000137 67302) (# FBlc0000005 161905) (# FBlc0000049 220083) (# FBlc0000029 241818)))
(less-frequent dataset_metadata 1 (# (# FBlc0002175 1) (# FBlc0001943 1) (# FBlc0002094 1) (# FBlc0002095 1) (# FBlc0002096 1) (# FBlc0002097 1) (# FBlc0002098 1)))
(most-frequent dataset_metadata 2 (# (# "mE_mRNA_P15_junctions" 67302) (# "mE_mRNA_P5_junctions" 67302) (# "mE_mRNA_P6_junctions" 67302) (# "mE_mRNA_L3_12hr_junctions" 67302) (# "EK_EP_cDNA" 161905) (# "RP_cDNA" 220083) (# "Affymetrix_GeneChip_v2" 241818)))
(less-frequent dataset_metadata 2 (# (# "ChIP-Seq_mE5125_HDAC1_E16" 1) (# "ChIP-chip_mE3893_Su(var)205_RNAi_Su(var)205_S2-DRSC" 1) (# "ChIP-chip_mE2667_Su(var)205_CME-W1-Cl.8+" 1) (# "ChIP-chip_mE2666_Su(var)205_ML-DmBG3-c2" 1) (# "ChIP-chip_mE4126_Su(var)205_ML-DmBG3-c2" 1) (# "ChIP-chip_mE6074_Su(var)205_S2-DRSC" 1) (# "ChIP-chip_mE3707_Su(var)205_S2-DRSC" 1)))
(most-frequent dataset_metadata 3 (# (# FBgn0011217 1890) (# FBgn0015790 1890) (# FBgn0040372 1891) (# FBgn0002781 1892) (# FBgn0013263 1896) (# FBgn0020412 1909) (# FBgn0261617 1911)))
(less-frequent dataset_metadata 3 (# (# "1616608_a_at_1350" 1) (# FBsf0000240631 1) (# FBsf0000240630 1) (# FBsf0000240629 1) (# FBsf0000240628 1) (# FBsf0000240627 1) (# FBsf0000240626 1)))
(most-frequent dataset_metadata 4 (# (# Rab11 1890) (# eff 1890) (# G9a 1891) (# "mod(mdg4)" 1892) (# Trl 1896) (# "JIL-1" 1909) (# nej 1911)))
(less-frequent dataset_metadata 4 (# (# "1616608_a_at_1350" 1) (# "TFBS_D_002907" 1) (# "TFBS_D_002906" 1) (# "TFBS_D_002905" 1) (# "TFBS_D_002904" 1) (# "TFBS_D_002903" 1) (# "TFBS_D_002902" 1)))
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/orthologs/dmel_paralogs_fb_2023_04.tsv
!(file-name dmel_paralogs  data/ftp.flybase.net/releases/current/precomputed_files/orthologs/dmel_paralogs_fb_2023_04.tsv)
(num-columns dmel_paralogs 11)
(duplicated-rows dmel_paralogs 0)
(total-rows dmel_paralogs 223055)
(unique-values dmel_paralogs 1 10772 object)
(unique-values dmel_paralogs 2 10772 object)
(unique-values dmel_paralogs 3 12 object)
(unique-values dmel_paralogs 4 10693 object)
(unique-values dmel_paralogs 5 2 int64)
(unique-values dmel_paralogs 6 10772 object)
(unique-values dmel_paralogs 7 10772 object)
(unique-values dmel_paralogs 8 12 object)
(unique-values dmel_paralogs 9 10693 object)
(unique-values dmel_paralogs 10 2 int64)
(unique-values dmel_paralogs 11 13 int64)
(missing-values dmel_paralogs 1 0 () ())
(missing-values dmel_paralogs 2 0 () ())
(missing-values dmel_paralogs 3 0 () ())
(missing-values dmel_paralogs 4 0 () ())
(missing-values dmel_paralogs 5 0 () ())
(missing-values dmel_paralogs 6 0 () ())
(missing-values dmel_paralogs 7 0 () ())
(missing-values dmel_paralogs 8 0 () ())
(missing-values dmel_paralogs 9 0 () ())
(missing-values dmel_paralogs 10 0 () ())
(missing-values dmel_paralogs 11 0 () ())
(most-frequent dmel_paralogs 1 (# (# FBgn0036891 247) (# FBgn0033362 247) (# FBgn0042098 248) (# FBgn0034661 249) (# FBgn0039272 249) (# FBgn0031619 250) (# FBgn0023479 279)))
(less-frequent dmel_paralogs 1 (# (# FBgn0040606 1) (# FBgn0030608 1) (# FBgn0263086 1) (# FBgn0263094 1) (# FBgn0030613 1) (# FBgn0037719 1) (# FBgn0013949 1)))
(most-frequent dmel_paralogs 2 (# (# CG9372 247) (# CG8172 247) (# CG18735 248) (# tpr 249) (# CG11836 249) (# CG3355 250) (# teq 279)))
(less-frequent dmel_paralogs 2 (# (# CG6503 1) (# "Lsd-2" 1) (# CG43354 1) (# CG43362 1) (# "Rab3-GEF" 1) (# bocks 1) (# Elal 1)))
(most-frequent dmel_paralogs 3 (# (# Y 220) (# 4.0 1269) (# X 27590) (# 2L 38491) (# 3L 43684) (# 2R 52635) (# 3R 59090)))
(less-frequent dmel_paralogs 3 (# (# 211000022280494.0 1) (# 211000022278760.0 17) (# 211000022279188.0 17) (# "Unmapped_Scaffold_8_D1580_D1567" 18) (# rDNA 23) (# Y 220) (# 4.0 1269)))
(most-frequent dmel_paralogs 4 (# (# "9007234..9013526" 247) (# "21798017..21799195" 248) (# "21799330..21800904" 249) (# "25071126..25072712" 249) (# "4651403..4652892" 250) (# "9074643..9092131" 279) (# "3206949..3208985" 384)))
(less-frequent dmel_paralogs 4 (# (# "7918517..7920131" 1) (# "770363..770462" 1) (# "11993989..11995432" 1) (# "11997900..11999340" 1) (# "22608670..22613656" 1) (# "9839776..9841163" 1) (# "5563977..5564815" 1)))
(most-frequent dmel_paralogs 5 (# (# 1 107829) (# -1 115226)))
(less-frequent dmel_paralogs 5 (# (# 1 107829) (# -1 115226)))
(most-frequent dmel_paralogs 6 (# (# FBgn0036891 247) (# FBgn0033362 247) (# FBgn0042098 248) (# FBgn0034661 249) (# FBgn0039272 249) (# FBgn0031619 250) (# FBgn0023479 279)))
(less-frequent dmel_paralogs 6 (# (# FBgn0004867 1) (# FBgn0031971 1) (# FBgn0046247 1) (# FBgn0026702 1) (# FBgn0032699 1) (# FBgn0039454 1) (# FBgn0031077 1)))
(most-frequent dmel_paralogs 7 (# (# CG9372 247) (# CG8172 247) (# CG18735 248) (# tpr 249) (# CG11836 249) (# CG3355 250) (# teq 279)))
(less-frequent dmel_paralogs 7 (# (# RpS2 1) (# Sirup 1) (# CG5938 1) (# Pop1 1) (# CG10383 1) (# CG14247 1) (# THADA 1)))
(most-frequent dmel_paralogs 8 (# (# Y 220) (# 4.0 1269) (# X 27590) (# 2L 38491) (# 3L 43684) (# 2R 52635) (# 3R 59090)))
(less-frequent dmel_paralogs 8 (# (# 211000022280494.0 1) (# 211000022278760.0 17) (# 211000022279188.0 17) (# "Unmapped_Scaffold_8_D1580_D1567" 18) (# rDNA 23) (# Y 220) (# 4.0 1269)))
(most-frequent dmel_paralogs 9 (# (# "9007234..9013526" 247) (# "21798017..21799195" 248) (# "25071126..25072712" 249) (# "21799330..21800904" 249) (# "4651403..4652892" 250) (# "9074643..9092131" 279) (# "3206949..3208985" 384)))
(less-frequent dmel_paralogs 9 (# (# "9896265..9897552" 1) (# "11126877..11129087" 1) (# "2079919..2081286" 1) (# "22080382..22083473" 1) (# "17849727..17852453" 1) (# "17830828..17841705" 1) (# "5093976..5095910" 1)))
(most-frequent dmel_paralogs 10 (# (# 1 107830) (# -1 115225)))
(less-frequent dmel_paralogs 10 (# (# 1 107830) (# -1 115225)))
(most-frequent dmel_paralogs 11 (# (# 7 4614) (# 6 6222) (# 5 8946) (# 4 14762) (# 3 27362) (# 2 39938) (# 1 105517)))
(less-frequent dmel_paralogs 11 (# (# 13 230) (# 12 1190) (# 11 2910) (# 9 3614) (# 8 3650) (# 10 4100) (# 7 4614)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/references/entity_publication_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/references/entity_publication_fb_2023_04.tsv
!(file-name entity_publication  data/ftp.flybase.net/releases/current/precomputed_files/references/entity_publication_fb_2023_04.tsv)
(num-columns entity_publication 4)
(duplicated-rows entity_publication 344)
(total-rows entity_publication 5580889)
(unique-values entity_publication 1 1952735 object)
(unique-values entity_publication 2 1952521 object)
(unique-values entity_publication 3 105916 object)
(unique-values entity_publication 4 63490 object)
(missing-values entity_publication 1 0 () ())
(missing-values entity_publication 2 0 () ())
(null-value-count entity_publication 3 "" 644)
(missing-values entity_publication 3 644 (# "") (# 644))
(null-value-count entity_publication 4 "" 3444472)
(missing-values entity_publication 4 3444472 (# "") (# 3444472))
(most-frequent entity_publication 1 (# (# FBgn0003996 4465) (# FBgn0014446 4694) (# FBto0000342 4872) (# FBgn0014447 5750) (# FBto0000180 5793) (# FBte0000037 11131) (# FBgn0014445 17375)))
(less-frequent entity_publication 1 (# (# FBtr0334316 1) (# FBig0000117350 1) (# FBig0000117351 1) (# FBig0000117352 1) (# FBig0000117353 1) (# FBig0000117354 1) (# FBig0000117355 1)))
(most-frequent entity_publication 2 (# (# w 4465) (# "Avic\\GFP" 4694) (# UASt 4872) (# "Ecol\\lacZ" 5750) (# UAS 5793) (# "P-element" 11131) (# "Scer\\GAL4" 17375)))
(less-frequent entity_publication 2 (# (# "lncRNA:Hsromega-RG" 1) (# "FBgn0037913-FBgn0286818" 1) (# "FBgn0025885-FBgn0286818" 1) (# "pA_site_034101" 1) (# "FBgn0003944-FBgn0013263" 1) (# "FBgn0003545-FBgn0260639" 1) (# "FBgn0014189-FBgn0035110" 1)))
(most-frequent entity_publication 3 (# (# FBrf0104946 130692) (# FBrf0213603 147340) (# FBrf0239962 162644) (# FBrf0241309 162865) (# FBrf0200326 176400) (# FBrf0202436 182332) (# FBrf0105495 545468)))
(less-frequent entity_publication 3 (# (# FBrf0201074 1) (# FBrf0126212 1) (# FBrf0134967 1) (# FBrf0144507 1) (# FBrf0125535 1) (# FBrf0155006 1) (# FBrf0086185 1)))
(most-frequent entity_publication 4 (# (# 15238527.0 40234) (# 22936248.0 43755) (# 19465919.0 49687) (# 28851752.0 57661) (# 29191225.0 75081) (# 17994087.0 176400)))
(less-frequent entity_publication 4 (# (# 17435764.0 1) (# 9345112.0 1) (# 29709602.0 1) (# 9013669.0 1) (# 12921737.0 1) (# 27591190.0 1) (# 25713358.0 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/references/fbrf_pmid_pmcid_doi_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/references/fbrf_pmid_pmcid_doi_fb_2023_04.tsv
!(file-name fbrf_pmid_pmcid_doi  data/ftp.flybase.net/releases/current/precomputed_files/references/fbrf_pmid_pmcid_doi_fb_2023_04.tsv)
(num-columns fbrf_pmid_pmcid_doi 7)
(duplicated-rows fbrf_pmid_pmcid_doi 0)
(total-rows fbrf_pmid_pmcid_doi 99294)
(unique-values fbrf_pmid_pmcid_doi 1 99294 object)
(unique-values fbrf_pmid_pmcid_doi 2 99294 int64)
(unique-values fbrf_pmid_pmcid_doi 3 43548 object)
(unique-values fbrf_pmid_pmcid_doi 4 91433 object)
(unique-values fbrf_pmid_pmcid_doi 5 27 object)
(unique-values fbrf_pmid_pmcid_doi 6 99240 object)
(unique-values fbrf_pmid_pmcid_doi 7 71 object)
(missing-values fbrf_pmid_pmcid_doi 1 0 () ())
(missing-values fbrf_pmid_pmcid_doi 2 0 () ())
(null-value-count fbrf_pmid_pmcid_doi 3 "" 55747)
(missing-values fbrf_pmid_pmcid_doi 3 55747 (# "") (# 55747))
(null-value-count fbrf_pmid_pmcid_doi 4 "" 7862)
(missing-values fbrf_pmid_pmcid_doi 4 7862 (# "") (# 7862))
(null-value-count fbrf_pmid_pmcid_doi 5 "" 10)
(missing-values fbrf_pmid_pmcid_doi 5 10 (# "") (# 10))
(null-value-count fbrf_pmid_pmcid_doi 6 "" 10)
(missing-values fbrf_pmid_pmcid_doi 6 10 (# "") (# 10))
(null-value-count fbrf_pmid_pmcid_doi 7 "" 10)
(missing-values fbrf_pmid_pmcid_doi 7 10 (# "") (# 10))
(most-frequent fbrf_pmid_pmcid_doi 3 (# (# PMC365244 1) (# PMC365050 1) (# PMC365176 1) (# PMC254114 1) (# PMC6569114 1) (# PMC365333 1)))
(less-frequent fbrf_pmid_pmcid_doi 3 (# (# PMC5728115 1) (# PMC6569114 1) (# PMC254114 1) (# PMC365176 1) (# PMC365050 1) (# PMC365244 1) (# PMC365271 1)))
(most-frequent fbrf_pmid_pmcid_doi 4 (# (# "10.1002/(SICI)1097-0169(1997)37:4<300::AID-CM2>3.0.CO;2-8" 1) (# "10.1006/excr.1997.3618" 1) (# "10.1126/science.277.5327.825" 1) (# "10.1016/s0169-4758(97)01058-2" 1) (# "10.1007/pl00006177" 1) (# "10.1111/j.1440-169X.1977.00345.x" 1)))
(less-frequent fbrf_pmid_pmcid_doi 4 (# (# "10.1111/j.1440-169X.1977.00345.x" 1) (# "10.1126/science.277.5327.825" 1) (# "10.1006/excr.1997.3618" 1) (# "10.1002/(SICI)1097-0169(1997)37:4<300::AID-CM2>3.0.CO;2-8" 1) (# "10.1002/(SICI)1520-6327(1997)36:1<51::AID-ARCH5>3.0.CO;2-Z" 1) (# "10.1021/bi970460d" 1) (# "10.1002/dvg.1020150103" 1)))
(most-frequent fbrf_pmid_pmcid_doi 5 (# (# "conference report" 178) (# abstract 191) (# erratum 306) (# letter 308) (# note 2322) (# review 13466) (# paper 81917)))
(less-frequent fbrf_pmid_pmcid_doi 5 (# (# book 1) (# "bibliographic list" 1) (# poster 1) (# website 1) (# lecture 1) (# preprint 1) (# thesis 1)))
(most-frequent fbrf_pmid_pmcid_doi 6 (# (# "Dernburg, 2011, Cold Spring Harb. Protoc. 2011(12): " 3) (# "Shen, 2012, Cold Spring Harb. Protoc. 2012(5): " 3) (# "Marley and Baines, 2011, Cold Spring Harb. Protoc. 2011(9): " 3) (# "Sweeney et al., 2012, Cold Spring Harb. Protoc. 2012(2): " 3) (# "Andlauer and Sigrist, 2012, Cold Spring Harb. Protoc. 2012(4): " 4) (# "Macleod, 2012, Cold Spring Harb. Protoc. 2012(7): " 5)))
(less-frequent fbrf_pmid_pmcid_doi 6 (# (# "Rizki et al., 1977, Dev. Growth Differ. 19(4): 345--356" 1) (# "Kutskova and Mamon, 1996, Genetika, Moscow 32(10): 1406--1416" 1) (# "Kuromi et al., 1997, Neurosci. Res. 27(2): 101--113" 1) (# "Kuhl and Wedlich, 1997, BioEssays 19(2): 101--104" 1) (# "Kosuda, 1996, Zool. Sci., Tokyo 13(6): 821--824" 1) (# "Kosman and Small, 1997, Development 124(7): 1343--1354" 1) (# "Kidd and Raff, 1997, J. Cell Sci. 110(2): 209--219" 1)))
(most-frequent fbrf_pmid_pmcid_doi 7 (# (# "fb_2019_01" 667) (# "fb_2015_01" 799) (# "fb_2017_04" 959) (# "fb_2016_05" 1908) (# "fb_2021_05" 2210) (# "fb_2018_03" 6651) (# "fb_2011_10" 53869)))
(less-frequent fbrf_pmid_pmcid_doi 7 (# (# "fb_2018_02" 363) (# "fb_2012_06" 375) (# "fb_2019_02" 394) (# "fb_2018_06" 402) (# "fb_2012_01" 407) (# "fb_2013_03" 410)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/species/organism_list_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/species/organism_list_fb_2023_04.tsv
!(file-name organism_list  data/ftp.flybase.net/releases/current/precomputed_files/species/organism_list_fb_2023_04.tsv)
(num-columns organism_list 6)
(duplicated-rows organism_list 0)
(total-rows organism_list 57986)
(unique-values organism_list 1 19142 object)
(unique-values organism_list 2 31712 object)
(unique-values organism_list 3 1044 object)
(unique-values organism_list 4 103 object)
(unique-values organism_list 5 960 object)
(unique-values organism_list 6 2 object)
(null-value-count organism_list 1 "unknown" 9)
(missing-values organism_list 1 9 (# unknown) (# 9))
(null-value-count organism_list 2 "" 1)
(null-value-count organism_list 2 "unknown" 7)
(null-value-count organism_list 2 "." 13)
(missing-values organism_list 2 21 (# "" unknown ".") (# 1 7 13))
(null-value-count organism_list 3 "" 56943)
(missing-values organism_list 3 56943 (# "") (# 56943))
(null-value-count organism_list 4 "" 57883)
(missing-values organism_list 4 57883 (# "") (# 57883))
(null-value-count organism_list 5 "" 57027)
(missing-values organism_list 5 57027 (# "") (# 57027))
(null-value-count organism_list 6 "" 57353)
(missing-values organism_list 6 57353 (# "") (# 57353))
(most-frequent organism_list 1 (# (# Anopheles 200) (# Bombus 206) (# Bactrocera 208) (# Trigonopterus 269) (# Carabus 364) (# Bembidion 399) (# Drosophila 801)))
(less-frequent organism_list 1 (# (# Aaages 1) (# Mononeuron 1) (# Mononychus 1) (# Monophadnus 1) (# Monophlebulus 1) (# Monoplistes 1) (# Monosiga 1)))
(most-frequent organism_list 2 (# (# orientalis 59) (# "n. sp." 63) (# affinis 63) (# japonica 71) (# bicolor 73) (# "gen. sp." 94) (# "sp." 6204)))
(less-frequent organism_list 2 (# (# prior 1) (# "nr. argyropleura AHD-2011" 1) (# argyropleura 1) (# ericae 1) (# pictellus 1) (# triplex 1) (# caudex 1)))
(most-frequent organism_list 3 (# (# Dvar 1) (# Dval 1) (# Dust 1) (# Duni 1) (# Duns 1) (# Dunm 1)))
(less-frequent organism_list 3 (# (# Dpac 1) (# Duns 1) (# Duni 1) (# Dust 1) (# Dval 1) (# Dvar 1) (# Dvnz 1)))
(most-frequent organism_list 4 (# (# "eastern newt" 1) (# rice 1) (# "Japanese medaka" 1) (# "red mason bee" 1) (# "laboratory mouse" 1) (# "fruit fly" 2)))
(less-frequent organism_list 4 (# (# "Chilean rose tarantula" 1) (# "Japanese medaka" 1) (# rice 1) (# "eastern newt" 1) (# "brown planthopper" 1) (# "common tobacco" 1) (# "starlet sea anemone" 1)))
(most-frequent organism_list 5 (# (# 132243.0 1) (# 7244.0 1) (# 306030.0 1) (# 95458.0 1) (# 30050.0 1) (# 62873.0 1)))
(less-frequent organism_list 5 (# (# 103846.0 1) (# 30050.0 1) (# 95458.0 1) (# 306030.0 1) (# 7244.0 1) (# 132243.0 1) (# 252922.0 1)))
(most-frequent organism_list 6 (# (# y 633)))
(less-frequent organism_list 6 (# (# y 633)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/stocks/stocks_FB2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/stocks/stocks_FB2023_04.tsv
!(file-name stocks_FB2023_04  data/ftp.flybase.net/releases/current/precomputed_files/stocks/stocks_FB2023_04.tsv)
(num-columns stocks_FB2023_04 7)
(duplicated-rows stocks_FB2023_04 0)
(total-rows stocks_FB2023_04 147006)
(unique-values stocks_FB2023_04 1 147006 object)
(unique-values stocks_FB2023_04 2 6 object)
(unique-values stocks_FB2023_04 3 3 object)
(unique-values stocks_FB2023_04 4 276 object)
(unique-values stocks_FB2023_04 5 142808 object)
(unique-values stocks_FB2023_04 6 143601 object)
(unique-values stocks_FB2023_04 7 146977 object)
(missing-values stocks_FB2023_04 1 0 () ())
(null-value-count stocks_FB2023_04 2 "" 1)
(missing-values stocks_FB2023_04 2 1 (# "") (# 1))
(null-value-count stocks_FB2023_04 3 "" 1)
(missing-values stocks_FB2023_04 3 1 (# "") (# 1))
(null-value-count stocks_FB2023_04 4 "" 1)
(missing-values stocks_FB2023_04 4 1 (# "") (# 1))
(null-value-count stocks_FB2023_04 5 "" 21)
(null-value-count stocks_FB2023_04 5 "?" 1)
(missing-values stocks_FB2023_04 5 22 (# "" "?") (# 21 1))
(null-value-count stocks_FB2023_04 6 "" 28)
(missing-values stocks_FB2023_04 6 28 (# "") (# 28))
(null-value-count stocks_FB2023_04 7 "" 30)
(missing-values stocks_FB2023_04 7 30 (# "") (# 30))
(most-frequent stocks_FB2023_04 2 (# (# NDSSC 2072) (# FlyORF 3059) (# Kyoto 25744) (# Vienna 38016) (# Bloomington 78114)))
(less-frequent stocks_FB2023_04 2 (# (# NDSSC 2072) (# FlyORF 3059) (# Kyoto 25744) (# Vienna 38016) (# Bloomington 78114)))
(most-frequent stocks_FB2023_04 3 (# (# "ethanol-preserved specimen ; FBsv0000007" 265) (# "living stock ; FBsv0000002" 146740)))
(less-frequent stocks_FB2023_04 3 (# (# "ethanol-preserved specimen ; FBsv0000007" 265) (# "living stock ; FBsv0000002" 146740)))
(most-frequent stocks_FB2023_04 4 (# (# Dwil 40) (# Dmer 46) (# Dmau 52) (# Dvir 77) (# Dpse 188) (# Dsim 225) (# Dmel 145074)))
(less-frequent stocks_FB2023_04 4 (# (# Dora 1) (# Dgrs 1) (# Dgun 1) (# Dnec 1) (# Dprc 1) (# Dcai 1)))
(most-frequent stocks_FB2023_04 5 (# (# "st[1]" 6) (# "w[1118]" 7) (# "y[1]" 10) (# "v[1]" 11) (# "w[1]" 21) (# "wild-type" 1649)))
(less-frequent stocks_FB2023_04 5 (# (# "y[1]; M{v[+t1.8]=WKO.1-B11}ZH-86Fb" 1) (# "y[1] w[67c23]; P{w[+mC]=GSV7}GS23035/SM1" 1) (# "y[1] w[67c23]; P{w[+mC]=GSV7}GS23034/TM3, Sb[1] Ser[1]" 1) (# "y[1] w[67c23]; P{w[+mC]=GSV7}GS23027/SM1" 1) (# "y[1] w[*]; P{w[+mC]=GSV7}GS23024" 1) (# "y[1] w[67c23]; P{w[+mC]=GSV7}GS23023/SM1" 1) (# "y[1] w[67c23]; P{w[+mC]=GSV7}GS23022/TM3, Sb[1] Ser[1]" 1)))
(most-frequent stocks_FB2023_04 6 (# (# "Dana\\wild-type" 29) (# "Dari\\wild-type" 31) (# "Dwil\\wild-type" 32) (# "Dsim\\wild-type" 71) (# "Dpse\\wild-type" 95) (# "Dmel\\wild-type" 96) (# "wild-type" 235)))
(less-frequent stocks_FB2023_04 6 (# (# "y[1] v[1]; P{y[+t7.7] v[+t1.8]=TKO.GS03376}attP40" 1) (# "y[1]w[67c23];P{w[+mC]=GSV7}GS22586/SM1" 1) (# "y[1]w[67c23];P{w[+mC]=GSV7}GS22584/SM1" 1) (# "y[1] w[67c23] P{w[+mC]=GSV7}GS22580 / Binsinscy" 1) (# "y[1] w[67c23] P{w[+mC]=GSV7}GS22579 / Binsinscy" 1) (# "y[1] w[67c23] P{w[+mC]=GSV7}GS22578 / Binsinscy" 1) (# "y[1] w[67c23] P{w[+mC]=GSV7}GS22577 / Binsinscy" 1)))
(most-frequent stocks_FB2023_04 7 (# (# 201049.0 1) (# 201043.0 1) (# 201040.0 1) (# 201037.0 1) (# 201059.0 1) (# 2.0 1)))
(less-frequent stocks_FB2023_04 7 (# (# 2.0 1) (# 201073.0 1) (# 201072.0 1) (# 201070.0 1) (# 201063.0 1) (# 201062.0 1) (# 201059.0 1)))
;;;Skipping file: data/ftp.flybase.net/releases/current/precomputed_files/synonyms/fb_synonym_fb_2023_04.pl
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/synonyms/fb_synonym_fb_2023_04.tsv
!(file-name fb_synonym  data/ftp.flybase.net/releases/current/precomputed_files/synonyms/fb_synonym_fb_2023_04.tsv)
(num-columns fb_synonym 6)
(duplicated-rows fb_synonym 0)
(total-rows fb_synonym 1001254)
(unique-values fb_synonym 1 1001254 object)
(unique-values fb_synonym 2 906 object)
(unique-values fb_synonym 3 1001062 object)
(unique-values fb_synonym 4 37453 object)
(unique-values fb_synonym 5 13823 object)
(unique-values fb_synonym 6 604083 object)
(missing-values fb_synonym 1 0 () ())
(missing-values fb_synonym 2 0 () ())
(missing-values fb_synonym 3 0 () ())
(null-value-count fb_synonym 4 "" 947217)
(missing-values fb_synonym 4 947217 (# "") (# 947217))
(null-value-count fb_synonym 5 "" 985999)
(missing-values fb_synonym 5 985999 (# "") (# 985999))
(null-value-count fb_synonym 6 "" 370940)
(null-value-count fb_synonym 6 "none" 1)
(missing-values fb_synonym 6 370941 (# "" none) (# 370940 1))
(most-frequent fb_synonym 2 (# (# Dana 19302) (# Dyak 19532) (# Dsim 21050) (# Dpse 22860) (# Scer 30891) (# Ssss 158119) (# Dmel 551458)))
(less-frequent fb_synonym 2 (# (# Ppla 1) (# Dsch 1) (# Dmar 1) (# Dlev 1) (# Dalo 1) (# Abelson 1) (# Amag 1)))
(most-frequent fb_synonym 3 (# (# "P{eve-lacZ" 8) (# "P{ush-lacZ.-2190.-1421}" 10) (# "T(2;3)ul10" 11) (# "P{SUPor-P.PRE" 11) (# "P{Fab7-w" 17) (# "P{Mcp-ff" 18) (# "P{Mcp-w" 55)))
(less-frequent fb_synonym 3 (# (# "\u03b1-Spec[2]" 1) (# "Dmoj\\GI20484" 1) (# "Dmoj\\GI20485" 1) (# "Dmoj\\GI20486" 1) (# "Dmoj\\GI20487" 1) (# "Dmoj\\GI20488" 1) (# "Dmoj\\GI20489" 1)))
(most-frequent fb_synonym 4 (# (# Amyrel 174) (# "Saccharomyces cerevisiae UAS construct a of Schertel" 180) (# "mt:CoII" 208) (# "Saccharomyces cerevisiae UAS construct a of Unknown" 215) (# "UAS construct a of Unknown" 235) (# "Deficiency (1) yellow Terminal" 251)))
(less-frequent fb_synonym 4 (# (# "lethal (3) rI327" 1) (# "Secretory Pathway Calcium atpase" 1) (# "transfer RNA:Cysteine-GCA 4-1" 1) (# "Antioxidant 1 copper chaperone" 1) (# "ACAT-related protein required for viability 1" 1) (# "ER membrane protein complex subunit 10" 1) (# "Structural maintenance of chromosomes 5" 1)))
(most-frequent fb_synonym 5 (# (# "cytochrome oxidase II" 33) (# microsatellite 39) (# "yolk protein 1" 43) (# "faint little ball" 43) (# "28S ribosomal RNA" 75) (# "alcohol dehydrogenase" 89)))
(less-frequent fb_synonym 5 (# (# "Golgin-84 ortholog|Golgin84" 1) (# "INACTIVE|Inactive|inactive" 1) (# "lethal (3) 01640" 1) (# "female sterile(3)272-9|humpty dumpty|lethal (3) 82Ff|lethal (3) 82Fk" 1) (# fritz 1) (# Or46a 1) (# Gr36a 1)))
(most-frequent fb_synonym 6 (# (# "mt:CoII" 159) (# Amyrel 164) (# 1360.0 208) (# Adh 232) (# unspecified 259) (# "INE-1" 2235)))
(less-frequent fb_synonym 6 (# (# "GA15920|dpse_GLEANR_14759" 1) (# "GM24315|dsec_GLEANR_7324" 1) (# "GM24316|dsec_GLEANR_7325" 1) (# "GM24317|dsec_GLEANR_7326" 1) (# "GM24318|dsec_GLEANR_7327" 1) (# "GM24319|dsec_GLEANR_7328" 1) (# "GM24320|dsec_GLEANR_7329" 1)))
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/transposons/transposon_sequence_set.fa
!(file-name transposon_sequence_se  data/ftp.flybase.net/releases/current/precomputed_files/transposons/transposon_sequence_set.fa)
(num-columns transposon_sequence_se 6)
(duplicated-rows transposon_sequence_se 13)
(total-rows transposon_sequence_se 13564)
(unique-values transposon_sequence_se 1 13382 object)
(unique-values transposon_sequence_se 2 1 object)
(unique-values transposon_sequence_se 3 1 object)
(unique-values transposon_sequence_se 4 27 object)
(unique-values transposon_sequence_se 5 121 object)
(unique-values transposon_sequence_se 6 22 object)
(missing-values transposon_sequence_se 1 0 () ())
(null-value-count transposon_sequence_se 2 "" 170)
(missing-values transposon_sequence_se 2 170 (# "") (# 170))
(null-value-count transposon_sequence_se 3 "" 170)
(missing-values transposon_sequence_se 3 170 (# "") (# 170))
(null-value-count transposon_sequence_se 4 "" 127)
(missing-values transposon_sequence_se 4 127 (# "") (# 127))
(null-value-count transposon_sequence_se 5 "" 17)
(missing-values transposon_sequence_se 5 17 (# "") (# 17))
(null-value-count transposon_sequence_se 6 "" 16)
(missing-values transposon_sequence_se 6 16 (# "") (# 16))
(most-frequent transposon_sequence_se 1 (# (# AGCATTTGGCCGGAAGCTCATGCATAGCCGGCAGAAGCTCTGCGCATTGGCAGAGGCCGC 2) (# TG 2) (# AGGTCGAGCTAAATACTTTTCATGCCTTGACTTGATGTCAGGTTTCCATCAAATAGAACT 2) (# GCGGGTTAGCTGAACCCAACTTCAGCACACTTTGATCATTCGAATAAACAGATTCAAACA 2) (# AA 3) (# A 3) (# ">FBte" 170)))
(less-frequent transposon_sequence_se 1 (# (# GTGACATATCCATAAGTCCCTAAGACTTAAGCATATGCCTACATACTAATACACTTACAA 1) (# CCTTTATTTAAAGACAAAACAAATTGGAACATGTTTCGCGACATTTTGGAACAGAATAGG 1) (# AATATAAATATCTCTCTAAAGACAAACAACGCACTAGACTCCGGAGTAGCATATTTAAAT 1) (# GAGAACATCATAGATGCAGCAACGCAATCGACACCATCTATAAAAATGAAATGAGAAAAA 1) (# TCAGGCAAAAGCGTACACTTAGGAGGATACGGCAAAGGACTAGGCATCCAGAAGATAAAA 1) (# ACAAACTAAATAGAGCAACAGACGAGCTCAAGAGAACTCTCAGGGAAGACAAAGATAACC 1) (# GACTTCAATACTACCTTAGCAAACTTGAGACTACCTTATCTACAAATTATTCCCTGTGGA 1)))
(most-frequent transposon_sequence_se 2 ())
(less-frequent transposon_sequence_se 2 ())
(most-frequent transposon_sequence_se 3 ())
(less-frequent transposon_sequence_se 3 ())
(most-frequent transposon_sequence_se 4 (# (# 1483.0 1) (# 1481.0 1) (# 1316.0 1) (# 1144.0 1) (# 12.0 3) (# 1.0 16)))
(less-frequent transposon_sequence_se 4 (# (# 1136.0 1) (# 1481.0 1) (# 1483.0 1) (# 1482.0 1) (# 1122.0 1) (# 1188.0 1) (# 1487.0 1)))
(most-frequent transposon_sequence_se 5 (# (# 66.0 2) (# 7.0 2) (# 8.0 2) (# 3.0 3) (# 6.0 3) (# 1.0 3)))
(less-frequent transposon_sequence_se 5 (# (# 958.0 1) (# 158.0 1) (# 536.0 1) (# 19.0 1) (# 284.0 1) (# 588.0 1) (# 647.0 1)))
(most-frequent transposon_sequence_se 6 (# (# 23.0 1) (# 88.0 1) (# 8.0 2) (# 2.0 2) (# 3.0 2) (# 9.0 2)))
(less-frequent transposon_sequence_se 6 (# (# 7.0 1) (# 39.0 1) (# 4.0 1) (# 6.0 1) (# 17.0 1) (# 44.0 1) (# 5.0 1)))
;;------------------------------------------------------------------------------------------------------------------
;;; Analyzing file: data/ftp.flybase.net/releases/current/precomputed_files/transposons/transposon_sequence_set.gff
!(file-name transposon_sequence_set  data/ftp.flybase.net/releases/current/precomputed_files/transposons/transposon_sequence_set.gff)
(num-columns transposon_sequence_set 9)
(duplicated-rows transposon_sequence_set 1)
(total-rows transposon_sequence_set 749)
(unique-values transposon_sequence_set 1 173 object)
(unique-values transposon_sequence_set 2 1 object)
(unique-values transposon_sequence_set 3 32 object)
(unique-values transposon_sequence_set 4 389 int64)
(unique-values transposon_sequence_set 5 600 int64)
(unique-values transposon_sequence_set 6 1 object)
(unique-values transposon_sequence_set 7 3 object)
(unique-values transposon_sequence_set 8 2 object)
(unique-values transposon_sequence_set 9 344 object)
(missing-values transposon_sequence_set 1 0 () ())
(null-value-count transposon_sequence_set 2 "." 749)
(missing-values transposon_sequence_set 2 749 (# ".") (# 749))
(missing-values transposon_sequence_set 3 0 () ())
(missing-values transposon_sequence_set 4 0 () ())
(missing-values transposon_sequence_set 5 0 () ())
(null-value-count transposon_sequence_set 6 "." 749)
(missing-values transposon_sequence_set 6 749 (# ".") (# 749))
(null-value-count transposon_sequence_set 7 "-" 2)
(null-value-count transposon_sequence_set 7 "+" 576)
(null-value-count transposon_sequence_set 7 "." 171)
(missing-values transposon_sequence_set 7 749 (# "-" "+" ".") (# 2 576 171))
(null-value-count transposon_sequence_set 8 "." 171)
(missing-values transposon_sequence_set 8 171 (# ".") (# 171))
(missing-values transposon_sequence_set 9 0 () ())
(most-frequent transposon_sequence_set 1 (# (# FBte0000176 11) (# FBte0001207 12) (# FBte0000021 12) (# FBte0000109 12) (# FBte0000037 13) (# FBte0000675 14) (# FBte0000322 17)))
(less-frequent transposon_sequence_set 1 (# (# FBte0000948 1) (# FBte0001188 1) (# FBte0000890 1) (# FBte0000599 1) (# FBte0000793 1) (# FBte0000139 1) (# FBte0000407 1)))
(most-frequent transposon_sequence_set 2 ())
(less-frequent transposon_sequence_set 2 ())
(most-frequent transposon_sequence_set 3 (# (# "start_codon" 50) (# "non_LTR_retrotransposon" 53) (# "terminal_inverted_repeat" 56) (# "three_prime_LTR" 66) (# "LTR_retrotransposon" 67) (# "five_prime_LTR" 67) (# CDS 227)))
(less-frequent transposon_sequence_set 3 (# (# region 1) (# "dinucleotide_repeat_microsatellite_feature" 1) (# retrotransposon 1) (# pseudogene 1) (# "tetranucleotide_repeat_microsatellite_feature" 1) (# "transposable_element" 1) (# "SINE-like elements" 1)))
(most-frequent transposon_sequence_set 4 (# (# 1074 3) (# 8236 3) (# 172 3) (# 2 3) (# 5145 4) (# 331 4) (# 1 285)))
(less-frequent transposon_sequence_set 4 (# (# 1919 1) (# 282 1) (# 946 1) (# 7248 1) (# 6957 1) (# 5953 1) (# 3811 1)))
(most-frequent transposon_sequence_set 5 (# (# 1286 3) (# 1728 3) (# 452 3) (# 12 3) (# 5034 3) (# 9092 3) (# 5519 3)))
(less-frequent transposon_sequence_set 5 (# (# 600 1) (# 119 1) (# 424 1) (# 1593 1) (# 5642 1) (# 2624 1) (# 2562 1)))
(most-frequent transposon_sequence_set 6 ())
(less-frequent transposon_sequence_set 6 ())
(most-frequent transposon_sequence_set 7 ())
(less-frequent transposon_sequence_set 7 ())
(most-frequent transposon_sequence_set 8 (# (# 1.0 578)))
(less-frequent transposon_sequence_set 8 (# (# 1.0 578)))
(most-frequent transposon_sequence_set 9 (# (# "Ontology_term=SO:0000205" 12) (# "Ontology_term=SO:0000551" 24) (# "Ontology_term=SO:0000318" 50) (# "Ontology_term=SO:0000481" 56) (# "Ontology_term=SO:0000316" 62) (# "Ontology_term=SO:0000426" 67) (# "Ontology_term=SO:0000425" 68)))
(less-frequent transposon_sequence_set 9 (# (# "ID=FBte0001033;name=Dmel\\mariner2;source=?;type=DNA;subtype=Tc1-Mariner" 1) (# "ID=FBte0000773;name=Dana\\Tom;source=Z24451;type=?;subtype=?" 1) (# "ID=FBte0000591;name=Dmel\\invader6;source=NT_033778;type=LTR;subtype=Gypsy" 1) (# "Ontology_term=SO:0000316;db_xref=FLYBASE:FBgnXXXXXXX;name=Dmel\\gypsy12\\pol;translation=KKCKASLDYISSIPTGPRDPRPFLPMRLLNCLVYGLLDSGASISCIGGGVVQAAMENEKFKSLIGEAATADGNSQRIVGLLKIEVEYGDIKKLLKLYVVPSLKQDLYLGIDFWKLYDLLPANLKIAEILSPEPNQQTVVDQHELCEGDKAKLANVINCFPSFSQEGLGKTNLVSHSIDVGTARPVKQRHFPVSPAVEKAMYAEIDRMLRLGVIGESESAWSSPIVMVTKPGKVRICLECRKVNSFTEMDAYPLPQINGILSRLPRAEYISSLDLKDAYWQVPLDPKSRDKTAFTVPGRPLYQFKVMPFGLCNATSTMSRLMDKVVPAHLRNEVFIYLDDLLIVSSCFESHLNVLRELALQIKRAGLTLNVAKSHFCMRRVRYLGHIIGDGGIRTDPEKVSAITDFPLPKSLKSLRSFMGLCGWYRKFVANFATLSAPLTDLMTTKRKFLLTKEAIEAFSKLKECLSKAPVLCSPDFAKPFAIHCDASKSGVGAVLVQVSEEGDERPIAFVSKKLNKAQRNYTVTEQECLAAIVALKNFRAYVEGLPFKIITDHASLKWLMSNHDLNSRLARWALALQRFKFEIEHRKGSLNVVPDTLSRVNEEIVAAMDLQEDLIVDFDSEFFQSGDYVKLVETVKENTSNFSDLKVESGFLYRKAEHLTGERMHDEYAWKLWVPKELVSKILARAHDSPLAAHGGIHKTLERIRRYYFWPGLVSDVRAYISACEVCKSTKSQNFTLRPPLGKAPESQRFFQRLFIDFLGPYPRSRSGNIGIFIVLDHFSKYVFLKPVKKIDSSVVIKYLEDELFMTFGVPEVILSDNGSQFRARTFQRLIRYGVKHTLTAVHSPQANASERVNRSVIAAIRAYLRLDQKDWDEFLSRICCALRSAVHSSIGTSPYYMVFGQHMITSGSTYSLIRRLNLLDDRSLKFDRHESFEIMRKQAVDQMRNKHNENEKRCNIRSRVVSFVEGQEVYREISSQAVSKPVTTPSLDRRS" 1) (# "Ontology_term=SO:0000316;db_xref=FLYBASE:FBgnXXXXXXX;name=Dmel\\gypsy12\\gag;translation=MGLDRSPTRKSPSVSNPVCKLCAAEISTQDLYVTTCHHEFYRECIGNHFKKSEICSRCKLTCRPPAEATERVGRETRSKTKNRRNSRRGSFDISQRCGEKLAVKLKIAATVDGGPSTSASGANANEASSSAVSANAALLAMERRLLATLSEKMADLVQNAITSSMQRIMPTPSPAVVVTASEMSADHPNAYERQYLASPNPVPSPRSASSDLFDRPDKVVHILNGWKIKYSGVGVSVDNFIYRVEAVTRQTLNGNFNLLCRNISVLFEGKANDFFWRYHKFDRVATMGTERFCTALRLQFRQSRDDGDIEELIRNTKQKPNETFDSFYDTVSELVDQLEQPWTANKLVRVLRNNLRPEIRHEILNLDVRTVSELREICKRREAFLADVRRCSSYAKDTPFKREISEVCHESEDEVRSTYEAENDIESFSLVCWNCRIEGHRYQECIAERRVFCYGCGAANTYKPSCRKCSKNFKVGMSKLPVKPKTSNAARNQSTMTDQ" 1) (# "ID=FBte0001136;name=Dmel\\gypsy12;source=AE003789;type=LTR;subtype=Gypsy" 1) (# "ID=FBte0001041;name=Dmel\\gypsy11;source=?;type=LTR;subtype=Gypsy" 1)))